%PDF-1.4 %äüöß 2 0 obj <> stream xWKAϯ0cWU?! $D<<'uU֋ߪy$G=zvv`4'|xa~6`[C.]0!<(Vv'yqcaEK -ϼ,wz@vkw5ʁ2# .&ǴO7ܟc=;=ʡ֢g,av 6(f́]6Y, V٢liHVq,p*HA*g[[(>ۏC(o1F6Nt+`8ݸkc)F>U IXEҪ}:\H6v\pY a~P1g"q0(.1]Ů"D3.FY,X X $xQ&HRzn"HZ^b/Cst%RVt ѵt:S.!'r!I/Ki$FE!c7uq'ىC5~s<`ϖ1o~oƆǽJs(4kwY?v! 3WԼ|Mk Wv߽b91Joɼm Jhyj|NM& #,WJ6q?6ߛV5!1L]j81x2ŹyԾ cqcun5XAr#tQQsQl>C9Hedev_W/A7zG1x[Ti']lu M¹v2rƕȋ"_m5Vp!\ˌ 9b>T}ͅȨ\ENE* 3kD_oAN3Eɓbn@nXs֮[0_3 tQӀ//ZӠ]K$/_.oY7vlff0%eaz3]I,> stream JFIFC     C   /"  4_ؤ+>Od8)&1>i׶^[|W[}NSvGWt~.0Y2LSGGlwlNadTT1-73o5u=EV2%Zdvd-E4FJw% a% 027hWa SڿCvި-8麹,vKoݕ1= Hާ#X N~8wFUW'`ňhC jWV3v hze"|"UtJned4v$Hs\0 WCskE$o(nXE4F[cY#PW/v]ixJӒfV鄟.W.,t{rtW4?{i&2>堤[uwn߿Y53 2!|,āi.[,t+E_\C3!‰Aup\-C=SjAfB˺52(01!Q"3Aq?Js 7ñܺAU~lT=;}5J|< !1"2A3QRSaq Br#$@s?٪W >h?6оB>ћOJa'Oɫ]i}$ _ m_MsT8f?\qaq*+g,gj {+ėS%efȍɔyq?j68-4cXqGGʵx)@ ><},eF9Vg`a,H1?[Y> nlz0:ի_.4k#BP8+q[jyВM%[uViyEGMƩ|V蜱iƊa0;Ѿh#i}>}ApG7޴ ֋#OfT +pЬ [{wnXk+vޘ:g 6K,M*^H#Ddu'!1AQaq @?!C7v#?] Z`T')q0qKs ZcvPswQÆ6!"6֝4pjדѸ;3^zN F&kT8E`v} d%YCZ$Ez>=!pٕEQ4ոA#<ЖF0 ~/HMJk5r)o4QTSgQz{CjLذ:2`J pph.^L0Or. s+bE Ы"Sa I__\oQ?%aQFe.;%aډ`a;I+捨0l) 5 G8hP M阖 .d%Y#RF(RHLک~@|E<_ cR&4"]ڙMDH_SȓIܤ^PξkWg+Cp y$P} gxjx3KH}կP Tet"La=1  g 4je\T@`q.WZs+? XXH_D <4-ADaq^7]CSU!1Q a0A?@ucAZknIuXa(XXߢ%Γ{"F674PjN)~o&OUv(0.._01!Qaq?P% sG#X>㜚z2{BGE#!1AQaq 0? GH!@s`K' /'iVsB}lR N4?M p༉zeCh@,7tɏ^9L lwKIs{{?5[P{MlB'@ݙ`w7;uma0NA0GYC^?xvY?__k{ȿFxی.eBG01F$~5awWr%DfPLIw_X A#S؉*aY#ɚ* of9F9{"yB5k v*'775wXn~ե} xO<}H`dfFltCX0yM>OE.˹; T/ +bThjmyJ0?ު3gF#t+G]HUowM Ӏ@q nZR%7VJnIQ:i)S/ƅŻL1Vt{_kI n1u2Y|"u:ѤoxDLQ7ӊЧJmЂÕ0sp$_M512ف0S5 `=`?_D'R7J #7}$pJokW ZB_eA!7}<9iCC @":1<}.w3Ndł5Z *EfF;#\ endstream endobj 6 0 obj <> stream x1 Om K endstream endobj 7 0 obj 30 endobj 4 0 obj <> stream JFIFC     C   " kJz&.tc4flu$(qHsTivIw:g$&ـMΌO/)d3OMV;݇WI5xްG.JuX0pī:jg]%bxa{+q:81EpH]9. 5e#%݌/ ZD7B֌QLc¿ŘZ8Ôicuu0~eȷ3~(Aƛoڣ*ʷg- ^xsM`(G|r6fhL}sgQq)*J?rp^.HT"݇_)ĕh:I8itЌ "~%nH-f˕&!@n)uSXkyV_MN5ZXZF&aޱ5I=,+ZzhiD:Y1:dYb~wd f4ϣ5oLn;l)-&C+>j`zl4+,^17̞t7]yTRR5xјrYg}J=|y̜m]@!#LىR438Q`4kA8]iȉR7^a#ؒR QU5o&; ,|r~u#q>67 [Uc!R( \)fJtVEn/[մGT,6a2Dܕ8 Y*nXKp.Uc XjM(HTR.:Jt j-ޕkVjZZVD +!.-1}əQuX<5Ll|<\aΙ:f"VQ~Bv29A*/GĖ:ORU@vx e·XM;iNчJEIf:z\)ɄJ-3[rNIv&RHsED[[K:Ѯ*BCS^" vGyػRq9\DJ4;Z[(KlIǓP3!_X:2]JH8D'u( ę2nny;%CX .\p=ƽ|\uǼ5}!P&:UR.< pF|؛H / X6vPcfPuqۢb"݉IGN)Km[m'Wi&+Ola+|֢kAӒ{GFCقbvغ8|X|h|mĭg#D[bhj 5XʜՃ)X;6_ _+mA31XQ2ZY[̗6 DVFdI!?>t _^AmW`R)y\^ yJzSqGYQ,u,}N'!XR3){E׽} ~|+~+dz ߺlcc((p*eb~t @0, &% P gkNcM0X,G閮a|׫HCN5v >u3!"12 #356A$%04C`Ë+f;cF;Ġ1%U(wF$cSRa0;c 1ݕ丰Æ]VwX x31313C">/+=V{°*wY./(wUqIWzwCJ1e(L#Ʊ݅(waC PsnTCJPcjuLXT"ؿ```-[ՏAeN'(6#׀2lt¼ !fܥ)j[Xܠ\x````-9GEJq6ڍ7Rۨc<%; N=%5J!LttOO˰H1Ä&{/txHn%NO<^ADž%DT%#SI/툦DJ"2" 6Dx>E瀣GQy*oX0*rd]Q os:))Mŷ([&T26%rzS?heBR +h$Y O1=Τ>/RQ?WK S}KE{`UqRM'.02^1_4hoәJvڰyGS{ۂ0N Æ{4IeYdk%](FR66V^' atf ~:'⭃騇L“%XF3m^nI, n6". =] FJ$W+1`d~PY\L 47JxxݜNBF[To 6JUvqm2<HGsFA{'D`{Fn'A՚<{p8[U5qFGQ0fEK#倏l/!Tѵ $GXͥ[K2rѺY,Z$myalK?3yG'\&̰ ȌDm\EO`&AϚ>AOOdn w̍PJZ>~N9޺0>&ԵtDw,GvIfnW6)y^C퓤A+4J٧%\p >W&Aߚ>AW$m/{d?,-:KXRWp?R$fBzqЕ8{M.4Y%?+j+,NM_ؐɨ{ z7i -)fLhsΕӒ(y h#>ٹ7-&18?}C yi-H7N Ғ㏳z$J'~#9"36)A R @JDƉI4rm3IZvSfkQ!e#>RZ,Ldd6qͫȋ౐-MGmΫ8J܂r%{rC`xJL0ɾKEۍ$ I&jjƇn]$)FxA(sH:!F%%҄K 1E'I-"䍝"\3/mr-A>BS#I1@FmJ#s9څEE.?vxpA^P߅~S Zy6+P7饅GQ嚙 +ɞ `h+#####p7 Dʟ܇qrwpEߒ]xFa<2Iv'עG Vk5G /)gzc7Yl/k8g}<>$vvvvvvv/S|8J\ڃ0QvP\+5}Oka* euG]ZcU=-Zf>=k[G/!HI尷g'TLyU>c1o!LCh妠#Ie Hz|4+X%JaEțe"Du"IȽfM%n|P5Uk8յj:=k5%}힢s+•;P 5ڎ] 1r֭}:e#UF.4uEu PGFlYS[\Z~٧4\@3YH2EvWB̨g~?_4=\I7XL]dUwjޠi[VͰiefʖATZԫJUfq}e"YϢ*Q76[WtJZ$D.9&N`m-غl:UVhur+y4v5#Rj+tl7qeaKӱwHBv}6~=r%إѨʪ$J%GW2aœ+HAbjh,Ti(Uh6RkګsHHA6=TGҰ]!À Ӟth#KS w^Ғ-j% ]#ek4DoF÷5ZƬ-}5VZ2 #SY\T*6+$Е$Nӱ'J=!1AQ"aq24B #RSr$3Cb?m$dzEZXXWTCET|2L=5!Lާ>Q<ΏUæ|Q>(GNMOSd5+д_z*;pWIuO`]kM™{:?ojah61(ub fk>?Uz_OꝂ`{UN%?z 1{tU4.a4AiLn: uQԹK QBy@ 가4[_ jvcE* /!Mz.w*^sCӸN`x o'^ßX|@3Ue9tࠨu#vzv`Tv>;l'ٙi)MPekL8^ :ɟ2{ 6,2>Y{8`xX!NJ ޶ ݴwUQ^QLF:ɪ2ayPLX&;B˜E dѢeCC;EYC$ sYRaHv18$$D.ĕҹuK$L)1ܔgeͬwS. N܏ u+<1(*rNQϼ梏m2&0X"淚}[[~z][&zm$+|y,Ò.i/4pKMŪK@XSa:r 9O^0HP&jJp4d bX픐Yn6Yb賵jd?5sTMɀ'n){wSr=T$%a-e:Tc;" ?-~D/ l7QomG˪aRӠemVI<;rEE YyڴV; M˪Ğg([GGhKitUZDIrg-ƴgrm;oիD>(n|%{*FB Ȣ$JTe춛;&ƭ>+F>tChY:YiE7E(2J"})a.E)2]W> 鎨z.Ѿ׾ފPī|<.Ï?5bK ȞH>|P+z{EN|4ϑWQS]'$\SQp"cr}m{_|+hPSQĹ"RWv"*wb!Etd q1w}%rD9GE4>݈q#Ց6j(#`:1?Z@TblTMm#m`~Ձ#Usި6*)*r5$ܩ<7[my$98\y[jdWv6HZu%5)cٹ9&b<1܄&"xݢvJ_RE)W yyB͸씾jMأ75ϧ6vچY[{F-k*]]8Yt*PW8MZHۏӃMr*p#ǤmBXۏn7J 4 q <0*ݑ`*PR܊m#6iFGOO !1"AQ 25q34a#0RsBr$b%@CScdt`?o,gCG#ʺx*#ʺx*S٣!ƚҝEUd{GTy[^z, T<c1VUӧE #%x+*{T}=SANoEE4hj=?pwt9X{?Vt⨙a)k#&bZMؔrwA)F&pTkBt,=[NyC4hET/zϢrx/Wܝ- Prhӎ~CU45*PUi[p\3AÜP7EB70Gr j @PnªCYmÎ5(Єi|Q3拣5hY!3DK{Cb-~3zxr(hJqϘ(+M-MANo]f@Ѳ .e>9+;\+%HC9<>{roQӑCOY!x9]UX+~3kpӎv A|Y16=(.d:0L5upurVb^ kDuE.m7o5Mu<G4{N5ت({O*\ǝ^`y>&n(#~ӊ:A.!2Ovrk Qpm]pMÊ[';Exr"' Pn%6[Ӡ/4 WcC@t[%Si$A4C pA9abk9aF۷_\LUkskKU'sx ۂ45vt[ *n*aB9cpoӿ$FDkQU˾&{wD;Z8g Gޅ#Bag5{<}W5{<]W޵{<]Wޅ^|^z{<}Wjz0E#?Qzgx ٙޅ<PD}^>}D}@1wzнD}^zֿBxz<}Wޅ{<}^|{<}V0Gބ^^^^^^^^D#Xzн>/gj}r=ޓkgg 4΄%$lBh5-6TVOJjIZ+EE!oV͍2Z$2XE]V)TGyi&wZT }3LG[=.v.gXfZѪ{U륹$-ܿE*JעUb߂sYU׌p#`А@^, ix&/l`}lH 9rt\,6ɠHmA=ю5d+S4Y4Dbx7b4:VHFZ2?_+T?SNEk8Rv ΍v-=ۭNu *Ib3]t_䬐Y}ith\f%H#Z ڵDl6+u†Gjw]94RII-ՋY.6 N+ShW%/RO6jYnZ&u•h-M2]E,V5 +RO3OA4F٬޾pQEϐl)G'F6!"iNNνCZ_`o(-cG*g7&Ǐ*>g1Υr1EwrfMXuN HmOlB|r>߀*gGeLЮVf8=\%"ؤؾCM ?'rGbprphtSZ" XY$Pn]7_:LZvVCg>"Mf;mX pAEKĀm^-VCg>"Mf;mZid#\1V,R7.K ,J7FcfqjKD?[YeTR04}.%#tw50y'[t Vr+i\5ड़5e6N݊@8a:FFl5s -gE;A6&v_kdC1wHuIu-4Z\2׼PTH/KjIJ;:h:5쓣+kKri$R|Df[]#/8j{RD, RõE*YCѐ:XA5,aPYY=5YEhi轹k~iFFONBbYqxGJ0ޤdckEVC?I"`s:So|{TXquWhɡj""(reu/g^ ;뫴(2CW7 uwMv3v4#'I1p"s3 $H(DM|b(hmg6&v_CہyKSػVp)ܞ2sп<ժx#h5py tjX(?X]~!2dy)!1AQaq 0`?!X_;%nBQ]4mOǀԱm0|0%ǖ-4sv]*w[xb{;MM?%\4n!\" VNtLP;0g6Ñzv3y٘M`f R{whXPg3=_7uwh z%5oQk02PmnLwK>w:;̘ٕ&mZ䔩[Z9rAjl*`\k]St웦Vf2jw x2RݠU üij q 07j#6Q6BםܽrbF2ڕp1 8fVc.#Gh?%&,<(PF6u&9dz$c!ԩh)sYBG!XKP)VCљnWlYxA4F7UfPF2n@ \` Q=ԢtVH`Wh !qJp)=oיxAH2s(1m`  -[cTpKA@M1q{QQsA?HBBl}p)[r_.*ЗiT5.7Ė$:jaWy)iI1SMB+j!gӞ?M9]p~zi:;fA 8F*w8*69~$IX=m*l1n9&tX* U H,كm>AQ3԰1ѻ|ExAҿ~l?e LO*bKES51l#]q,z$/t%/4yTx36SV}"\x%ߋKh\_3ƫ`n(B9i[x-o^,fᶉfQz9@4T痴Q1q_V9yn zS풹t=+kuCq) YK0\ד4D:p$Aو?àj!_\EB =eh[+je< ?:V[yXt/C/yByGf k݉H,l=̺B!u09B\@DŽs |BKlzCrۿS}ej#_kr49f x)bze* M^w3riAQV1 DiwCc_gcЄ,TmH01k;q;/R0RrG-tY?yI>"Td;p_)M~0CLh5?3.rςȨ&)T&牵#yK?wCv! hãmEk$~]6eˑSX+vLĭ056;]+`+ L:8 ~+"ҍaK##=DOl e4S*%p#i@KL."#L=&w_9\`DBl?1= GVu>$ZDn^7cDڃhc1K?lYQ;bZ/2TQx-ZʭDSaK-EyT=Ӑ+!r*qѸ~'R؞%R!"eRDh4{2qR!1d G ޖ,"4YZ }-aȫg mKfQfzzK/Yye8Jnf[4+g^ ]]~`CEٗ Vs"~VЋ9Ƴ '{ω{lݒĠ UFi::zz )_I8 yۣ{FQ6j~mjp-w7AQ%crf+nu:4G&z,=.W%mw}]! J/A=ΐ$g3`˞Jz'/+wL$pdTo'*R格[}}-% ^j(g ܮ^ e_H^=ޗ^iH W"ʘp AiLNU5et09c(zK'Qcx8 eTjs֥D3)3VA2e(9Z;/>>Ļ*͓LU8(\2ýw)QX̶u)5Z~H2=Fcj7x ]XR[-5g9g-s Ϯ ~>=N9؞+~;Ϸ`c|Y&s_Wտ@iFWMzk^יg-LefØF|?rBL!H{!zc5xX,wkQphŨ9ST'mqϤLQX/vZ6zPV.k!1y!DPcۚ#GBUvUi٬quue0M /{`BCP./sn;\=8Wm,aYDgbUةF'xx ZRHR"JYBwH1JV y촻\t.U hmAB~@*`](Qٸ[,gvx!b٨xJS+|v#?uI[Df@kQ#r4} Ju߲c\UkɟHqEm}f{O2I,t?t=iŮi;v ^Fj*^"Y{,XNa姘R3k}E){!aF>9%߬<^P=8B31tlq-1m]y|K/Xo|f.al $\JF'f\E~ެ1,^Pýc+xߚ*A Aо\!aת}'Ps{gUܩl~ w?1+D涍? z#hQT[V_J=Xe-Vo>[+S/*aaU; ǤV5-kv=_H\Ơ5u1 9 x-+{6kvf`SJ{Y ⃼dlDZW3ϮYv:pdbX (;c6b*62?c=YC, ͌`Sx`cU!o-#uYP -U^~`LH7~_8о!H $*>#k+ 櫞( #BVP̾*`9X5DZ ˫y+ ʸ$jPZ, e%_.eFt=;}k;?oAؠoH[Hgٔg~*>Hw.~(3f'(FM߼bu +*(pG3$QsΖ&m,U$ 8T+&1 jdu6z^#$9E4ՔW/^.܃;8G #e Z,rϟ<׼~?]aJ}l'^U+M_pqVOaʛqev9a4V.<⾷GoϘgDf/ÿaUoDsSقY:RjC.% g#XW#S[ %&F7,Vgٿ)J;F"qW*h*p^ l:y/zv^N>wu6·95g_>/}H;ZȫxpUÊrDפ2sF!Ep6?'!1AQaq ?nE;V Ȧ/Bxa!<)|A}ɇqKBíň%O>A -PD, Tq>+"zcx { u)Ŧߑ7OQFq!>VADN%0ٹu!  V^Xe#t\PleQS_폴']AN*W<<ˆUu%,K=eXb5$PWp rK7=⬳"KVf&mdj8 #^5%@h01J`*@s*폴[E;nx6Bor˸%9i)WtN6셩 ԨU;'Xځx'*,5L76Q7n[^&wÊ㟞!EgfB5FIU0Fe%jHa  K0 5.Q倥1Tl?W Hx\c#팣GL[j^V=b 2ArWcC Z`D D5:別w*R1 XuWOH@E ?= |='QNXJ7p./+1h弿='};I~zLs>Lp*YGy(Qn+~5.j 5%<ȼk-.Mw,k˿ ߼x _+1 u⹾+ΐF g[M!*6aR֡u7̫t Iz))Ř~z%yS#T wE2D@^]%E.1U!~ Nc  r]zel]wzANRV`ۼā)4( )!1AQaq 0`?+V BT.W*0v=p !w b^81ڶoN~ - 򁯓=sX XP6J%R#Kˋlpi|nmP-}+qO8낣$ pfe2ՙC\Z5e-gL-.q>,-D*mjr̔;*Gvv 9XG3üYrZQ gؔH7kJ{~}bP#)Pl ]RTl9@q y<KG3*npsrRyQ(Yq%.cR7ғ^I+^YP!3ԸJ;ܦL*03Ύ JFe_/2ݺq~RJP PĵӯXm|dLKClmC1UX4 fcS*()X t sРɝLŁ^oBt F8aU@Zo;\m X ɍGLs=w t >nSז7XPz7Յ/~5%F5Eq5DCsF,x5^c7.# DEY^Qp~6]c<+C&qkG."8KpFswIu`/E.Nc Ƿ]@"fֲUz6=xX Gø6W6hf H ^Cª]%SU>@^K|ZЍ 9Bǯ2efx״~&\瘆u\%c-}fg+=^ޏKtL5ƈ$|C3kjĐ Grn0$`ՙƿVAsyI|CތG1j6~U`U"QQ4ֳZU/̡_\ʞ~cl7dyBJ`Yαg-]&*V z` U^0i2%lxFZ1 v:N-5PR[YrTc*6FS,:wij(QI,[:xH Ѝ6W\ |3_څ 8T2q1c@#hŐ{)&_V4Z~$C0%W!So"ĩ>.F[rT+F0=]C]A$} T)ߘhp509Z8߯O!TX!(i7Xh4nuZ4))!tV{Q>>+yx3uW8,u#p ;DDQ̹U߫Jm~!y$4B俾c<`T((tiS .K^ evP`=!Fk,AJea-d CC7͆y 01w\!(cbT7@a˜:q0A{AZSSdR,'Oƿ*C_AfEG> tyUW*T< n;(Z%L-@-x,u lfyH"SLE b 8;TTe?LBՍG{ܦkշ !T! ļ :ZBM6gp6=~sG2Ç.P0(~ZcQqo7OSG&n1_53X^<8^_5u.$&qsA.jE͓WTfS)|s657 FxicK#Di#Y=2\\U$}Y[YViiDKC e QԱc6A" }e wd ؼO:R)ZuAAWnZs\@ڰ2e0CE{{LxBa:-} ٬`kWt2~n:j6o ;QJo"K]<3q vs&OK13_L xtAkj5R rpĉZy]`dx VrLir $u6Nb\8~KG;V%:ۆz}ϸA"0w)yͿKchA7{KR9s̭ Y+)J=㎑dL@ }7,dYVrs>̤,=D?>W+rW-[Y(OCI!4Ţm0 f/B]ߏO%SV @0}eҡ;Y(qOcxHB*rA?$Xf<\Sj_$PVP XC)](aO#*̘IͻZy [7f 21 %o[Gw:r_/wvT5ʩXfծ&VSn.sܽ'B@ňBnZ GDdEBUt'qa"'QH5f澘5QN@]x1} 后XkED]Kr_B 5C>kՁ5 5yDV[/V,^:-|BUDY'x6ˢ|,IۏUɩZ]Ui `fNYi>찭XWPx F&fnz+*U| sĹץ{kEy& AO'g=gyU9?}_x*_P4ĵnp-) -MN/Ouq\<@䂻| 0Ed\eKLd3|eb Ή2CR:eXC/HP]Knط%MBHo7߂L->/Ea0}qѼ, .s9H?Y w)kgxkZzAŏ0ͼ@wPP[Nj2~x8\Ƈ Z M.p@Zp (- j^>4>O[EH+'8&oXkvm|pbpM͒#2ԊUMBXEj0b5~"_Q" buӷ#yp R|oD@ZPG?AUmtZ„ mO^A/ds82䚀$ 'RDɬoH*\l湕/yPq @dR&ЫUQRMC-HU3|4|ڦ 6Ymxom@LAla Ԫz6r}巀Gpp"^~ziw?A8_aZXNzhSksBSXQRpwX `0 13/-[=# ;7GX4~4iL)"/%DrSj 35c}^^`G.Wh/|RƬ;U.*޵35Be'c4ՙdzxqcM_hԵ -qX?@⠑,Η! $wgȀmĻghM2qqI)SDC8q ^ \fX @ WFJ=EWf62AOTTq Ž%=S¿9K;s߬o68( W>?Bo`;艧i)7k! Jka1CU^O!gP&Z A& jiL8Mxnr!A~|umȫ Xiaj[k9coO`!S5RPn|֋#m0_1ՈȀ*3Kصp[e"nZhfMt3P$&$bEnf뻠 c qȭ7Wi3J]_ii}6s ˏJ՚xԅJJ!􆧄 h3z% (nGe# WېJC뚦\hҨٓJv@֓xېJC뚦]攦WHJTF uvB˩"p^T2DfݾKofWs0b9 Q:z1H4Mn!޳遘t+o4kQCjRkl2X Rp 9;y#+9l׵m%zWjH6WSSs5K'PYcYltQ,DyqDY72D$27[`.QlbTZ7HV3YI?TP((yAۂpTP ͻ|5ߌdžV D*[f +O(+E$Ґú橂q(% hUhҏzZy-KSnxcCB1qVSEYBP׫FuBL)!Hr_ 9bc#U a)< (sO 4iG<}( e4[9d%Ba_`Yt6mJWz1 `5_wjtSqjq `5YwA觀%p,,ml#eEp /oh((RڰnyB`/(yy} Z|Ng$9O#|VZ/n[iKjBc@+X,5+P`QX)(Q(k/lN pG^TmuPXF6o+k!, 60.6J)aW>(TuEHb"WL45`g2m+PoLjŜU>zD (9F[2UYHQꨂnyB` Qq/5pj ` XJ*!0-_>mu\5X# -C.9 ($D`-xP#@#䔠L,Tt&հXq,)jnm\J( a-aJ]t7RZ@UuEw ^2V-+Yvd[\"dz= BB*=*#X Z3A  )Oc"rXm•1aAQb-ASr.RՂťp[pëCV&:d#J("߰{jy0 MQh_V` h)cyJP6];f3/ iVBF_KЪa22c>%ڻ `q~X KoL 8 ^e` I).9s) 3:fDVgR-")U0R}-A/V&m _2 ˔rD_D ƣ40.TϠ5V(-XtkM endstream endobj 8 0 obj <> stream x  Om7q endstream endobj 9 0 obj 115 endobj 11 0 obj <> stream x\K$Irǯ@0tCH :] bZsٿp呑Uӣ]!Ґ_F=p~!ڈ_oۯ~J}s}}q/_sui[ݏvRy6z)>lm=er9  sp~_ޟ#1hx N$iHiD8z1`d 2NUbI:xNcq$_Y :J\1* U&x\r.:ϕ2!yh>Ăt|<āuM=|esƔ1b~|?A0@"#N7 31 @=@24nHDZ:n4e'TCTCIb!ANcz:]gP ̽y1P tAu<`Ãn# 7 U^PR3ĺpEՑxՑ "hl1p+,{/êqt5Ug8dٴaUHou; rXKXw6`ԥL`NU!lړƒOf󵱰Ru{R)j6`LuU 'df&@-V#O$E`gF @5@u*ɝ ^2r'i^I8>dWJ/QJ+J>]Cz{J"6m枕JhTBEj(ث." уkFf+՞U~^m;*E\sS߶Ձ-9;T7-suUG|r츷;_KЀ@54iк g565ޅZ} O)K5mXS(=q˶4kA.A:N.tkIN)Z1Oi .sM7]"ST7ֺ $y;.^REֹk¿Z$僕۩ܸ*De-i%R]M] \-E[\TۛRWբKRz`y;Kkp͵b_*6_Ka;\@{kzKcݐKOΊ\nvHf;>ÀmYZzNݨq[;Xuo^K?u\mmkm-:s뷭dW^K:LynH- Nm]`82~7Jcqi TF !Jπ s#Uq;2\]j";ZʎBͮupt5ǁB!rhWti|η5o_2%?UZ,öj!>Ѫefs*6:UMZO-*SelK57 hµbt}UZ.]_jy[>KU}&ɌT_sٵ[Ka󝇵#*.7ǶDn *Zȷоy@~fɒX.5#pt]_p&R(2x끄Iٻswdw\cHG OZK"ː ؐ}۝At.'V=!z<J)l]<(4Ye!,a<]ͼf[ih6 7VU%ޟ9TzexBe815=ћTKp e-]r! 4l'r M$w&sxϙ[ dJ%m]wz⻵j#*nYJ:䆢Zo~V1ń1uii&'KyL$ٛMAw}j=9O+Y&y;]RpH̾=(FT!wQ`Jijb'b4ܲcPm;8`D%@w+5{Um]+ rB+Y?/x X$͍,Y2^hLy=yH G$=VmY㋢˭A|D@)nr1g&r*NZ $E#<+ܩF'Y%HsEImvm⬢PRuְъ"&~d'qC!"MNU;5utFQcxe(9`Qz@V `2fQ| ]aXc&M^ŒbF#0 ~ؼs6 i+F<2Z_Y 3.UY `Jj~]R!MB ;`ܥ{>xN -SZ qp&h4ФFm$wl>4gd>@kC*Ije[ӄ.U ).I8O托IS߅׭ -([׵׌LD44 ҨrJAsi^oݬnypiEVo;l~GW=A[$r P_yUX-l0GԬ6RyA%Vp_g6}K*/\#xc7dulfM/ Jv(y :g hq~XٰApDl~Mܰg4&-`=K>p6ϓu8K rx_9Cb"/( ['+4t@`&4&7󽠺 "? ySٗl~T6Zd7|8^昒ȕq qN~ȫcX&~gpL8%d".wGҫf`FAM -ݹo8 WgUye$'=PɪYFpnYl xx  .U*l%U+``jwb{hN.$]LוO3&DVa e1]F^R P粇QŢsS&a0>t.X[n,$a+k%ho߶ٸ"?['Owty%B.w[Ƚ߾R QY^oeصzsTsVOj伬54z񠩺;Lp9Aڭ~.ڽ0)dC=ߧnU|]^4sr*_HM߾1𮑇qghfּޠ/J9PS'i*kqR9 `C\.EI*C6SmWi?Rz^cQD<)s q5R7Ѿ9I|0r~m?ZL(Npg#KD&}k ?rEKe\ZeϽ? ,OpV3eޣp)x-e l*L_eH☠tL1T#pԯUºYvR2QWywQQ&wMttz$ wie@P˛Sx5Y<-g@[chXS} Gg8hHf HSsa0tV]g ~|LJF-wrz☯1>܈+*SC,22#t||b endstream endobj 12 0 obj 5527 endobj 14 0 obj <> stream x]͏8nx^F]rۤ9%,\ߏERQ5eQ|dJ#)Y?.g /!Sq(C9KJ`9&rfh5!c%ZZh !H8l ɄaLy&I=s>9{_)9!<$Չp0YV$U,A@+cIbvlpo!]˂~_T|L"SA$ < Qc+G/f!4%^JhLĔ HG ,GƠq/PWMb%pRK=4V^VQ?+$lUi"I4X* TP{tXO"hcPrpq"`i0foUK-r(dDɑ/ėIo1蕊"Kz&d!PkYNŽx0P1QxK}lyLm2.e"?eJxЉ/l^"Bg]i@g'gNdVYQPp(M99B*fScI|+ݤ\:$ark*' DD- ˂KLG3a8RH`P𜊝l_m7@ ̈́ƒ $Lfrp FBAvT\AD+,B, B4^jxGǢARv(LyH2ԒKӹ׭a@̠X4va,.d.`e@ (NIM1FB L(NHG[Mܰ312n br7F|\̚e蝙2`i2z9q#μg?cs(4 rB}+6wz*Q}W.m#c%T5 b.ٟ[yzxQ|͕ϕw^yw񪙿}牯|ǿ%XV_Jce]5XA"$9vrUaU$hn7,sa #bR7E6bT蕯D(*BbgZDX|n[>*`b9&s#TMMd_Ta$T S ZKa` [!I 8E 0HDZ;䐔=dw mUc4uD6%Ԓ\0h v.dw!2AM6$LR jA4bO w<9d2zewsX7 ƫ7 6_߽WrjQ:+'5Dly9p!X *V^r6:R&OnTY*jq]ފ`I".) WrD# 6nI7,M *^@j[ l`rB)L0BFw&6ѩv\a9a8S\"Lp`膉 gBq"@!)|[!tD&rOZXG|%{A.)k$W|~_l$.X{p'<%:(TQ_A<áS.#@ $bfg1Ӥ+B+EMn c 80ȭ&9HKaj "F:d) MieD^A*%ےOcW4tѨE'r—6TD@LtQbϝ? .UAA,0BD(*򤶢<=Gǰ3b0E$.ED%sIJ-.LL2(޷ u0<OP3'gШ$ lrBxvIˬSY.2kDjBxZPPX6€*Ő(l0`*mKP' ("`~ٮKNXN&kBSU?MM1`&=D͌%QoD޼kJb6!$~X". 76# rgSbF$v<*ƈ)x0TV$j%L-H< F| hIF |ҫ%yBTG{8EIVB4H!a8J"zOs0sި,\R" MiDhN J$/VRZ!>0Li¾ojI1(6A )S#M1>i 2W`C(u &9:OOxG6eE@AY;G j#ЫrQB7er³w 䤥P;&ZTA,GY&בԓ&CM< tqey} JI9bAw),=6RJF1 c+[4SqIoL1v J8IG.H;K$0iF4_BK hKruqu"yy(#?PJYv2T=E&uQӺ8IzG!KTȚg fCoLV$!$A]-ȼQFV(>u J"ڒ86B+);Tye"<'B!wv8Ǐ8Ra*fU=9Œ; 8H=B*("ACH+B_}DrtFh.qGn:,. OHf$(/i.C 2MD2 4x'(.(wLmY΄O.B8aS=[KO0.=f.ɷɾלE4K@Tj5F Gu@@e.QZ1M.)Zb%EYLNȘFɲ&"߉zF`J͈tTƝF;%^K4ZbPіt3O$/` jHC[!#B|bqGX"L9=JvмX߮9__/" uCPRy ʉK_V)$[>0o#L3= jʼni-4g9K%֮RK(l땨yB)jOKe@-Ϭ%- `&.s=C-eZ*M F31-osփe<0e;`%e$OQZD.~ $ #IQ]Yc|˿|/_R<^>^/g\:^ \ ҏbD<=NI ;Lmj0u`1q)ɖGGS֓ѿkn'Ɠg. M#!U!a|7m1>DI"=A@ H @aS5ىut) - B=2$V7A6G]``sw. oH ؉╢%6uQ!\cĥq >Z{.)%?ق n =#;q)T|0 _՚}*\d<9]ehY^ߊUL^AAd A"hGxp. ctkI%˷'~/x] *-)"ފGeH0QY:fk w(e;X?`;[WD5sv&~QJ;N:\1WUhg;՝hK#.m@ YOesJB03zT`f¸ JsXCnvu?.I/f_Sj4=-sU>3J(Fw Ux#!S={ʾ,޶C]bS%Dhg OAȒa!,3̓.;z}5@bƞ -m쩰gy_WaUA9{]?KXa[a:H#|wWG]{c z/AoPd@Fw:~Co{cv_۞$?#NL7;˽R3y"6Cƈ|e.EhP @[94n6•/ Ug:;+h,gruܒMui.8R7ɡAzk95lHFy^lp–&VY:-ۻ6c™#=\^h,d9{z8d(yUCd|ǰPC0RQ @5HP۱\c~^ 'Eݽ_ #ݙ09ȏ@}KgFT]{u>ư3yMr A?!H^6T`ɥ^[H&%|¦ia,pbjc|=>tz+LMg}@}[*j]_1kL 9ҏAG5mH+g7$9l3Ts+nMVju(:fOd=$￷#NTj!to94d%j5#jlyd'nU*WG70(2H`'\C6&)1LTpXeeCXB\}!>u5lڧan uCrhXac8)y+lU:_]sv`{1:{Cș[Aw wM"q\/5zƣ8 ?9ҙ] hlD~*H9M$7O2 ",:9ʻ'?Cx{S3gLp /?F68%=PzSOpʑǨx&/BHUh1)QJIx̖'?oY|{#eeN|F|mշg> .q3.wO΄#igKⶦ%gw}Gwۃ:{{3g“#L]$AD->`i$gOl-mR:ct@ZhlR[='Jc?^\W_5B ה>Y2 Sac;K^mU3yu1ڃ&aZC6)A `(ߚC~ 8 TqzqKZ~/k1R+U4>״wgSMx056DŽ;9S񫔡5 V6?󱷲$)"y[| a x8 -.@wk8lX<~FBd6*?QÇ}rpY:]@J=<nn15j搂#y5A>x$6]~u|3nsގJ]\ip&Iڐu5QuAZao9W'G>t_t* m>qXIm.'8 n6;13uQaa9)~oIUIY]sX\co0:.~d?Ȩ@tCXD bƯKhiV4׃CWF䭒#/5Z(z*#_co<97Mؿ 8!`qm`+Awq"'X+TD _o^TVtUXXɋ P_sv?{U>Ƥ39`x1@z遽 V7LKg#5ZUoY4cL(9}XΞݍ|τ's"|.IakF1ڜJJjs*|9GA>+(ZJasnEEMҮUyyUOT٥lJ&*!&dngzvj\D=%>Co ցdw{ fUJoQ> m8 ]4ym`͝r[kg|b8IgӦ|^l]rv'\wޮؙ>8!x1 5Dl{#YY9#%1l :Ӽ՗dz+" ܫ0?,;i+l^jrvߣOc -> *6 03zp1] \ow(ח||@7$ M?R 5>qsv _;hF3yM 1hVcV"eVt0t:ig˟g/|&:idNQy@Ϩh;0-9F˜鏑Q jy"%_Wz :*|($o55i-NV{azV޴(N =vbI[oN{{T׷MczS2&w(dNxK^J5b9$}x~gGLdܐǘ=L ~&mrg(TpOKF3:|U}sH ׋ϩ4Г #֙&yc%W%BՄ9Au>Ƣ39V>XaAX8#z!k;lc=_{ζ꘯z&Vab9#$;7dpg ߅3=kްr&I~wl?X l??w^C6T`ۃ |y5w ̭`'阕Oe/7|iu{z|i{H!/n?CYi"\@w,|&_^n3?[}r]2$Cނ*{kд"#S 4 .aTb[_a &i eޔ,iI`03+sO w-HLhISst.kNG '΅FF6Us]zhGCf#֫qurް+?:>t3r{?8v[55cATN…)~A_SVY;=y61(ġ 8oju5vԽ{oIԚ> stream x]M9rWyn'I@h`#ml>>;,$;NƋ ROKղ |$ ㋙ˣ=u\鏿ƞڿ?O1p }<Σ@Nvo8hJytEnmB9zڵpf]bk_5P v75>Pې T܈ &䵛B%"uZ hB|G䈇]ڨm hm+*T nԭבH|;N3c*Հ*䤀m k{x,{vZiUǮ͵a׾,,q& (fHː "% qo-܁G#`!ƙDCbKB7%.'4'!sU S蒶K~@[˒i./$ h2vgՠV5 D)Jb4XqiaVx綯9 b-XhJj2N0>hĶ%O@5"{- 5HתA`x8'T<)@i tmfK atAO|dKM (m"'P_=>yؔm h0nKdAI6rP`XTt:N5hsJ { B?uX r"&~_,_qya1k’_ǜ0ihlYIE?6Jt`Uha!bHKj@I5I@L+QaNZ^-޶KUJC'Q1Mk`SRk0)a&JS"20%J~#O$E`aB#@2fN$O^2R㻗H؁OڳO/O^r<\i~  :L"H"ȑ X1L=ik]ߑLrpLVFZ5rk`=8˴m%QObdf666갫I3)YN+⍊fm6|V Lf lfԍg:3qf7Z6f6͓ޘn7.r6LsOb&fvv&7H9HI9Ufv&Gl%}j3 uM刚Zn\a$.^`fMAT7Eb8ŕ*T9zZ8GSli|=b"ys>/T@ T* mLY!sdΟLs1f͔f|*Kd)4di`-zM0)S9)f۔ru*r{S@?O<J:dž|UAo= `b8ziEX3m&ʽ`q9WkrQ-POY#cUpv1>,K>8X4l7hvͬRPɮՅ$uK^z/ٟuEaNK?$"IJY{c \ ÉP٨C8=IșgIM5%Ž@$F(2IĤ21 'YdzMT-/xgR|ECP!4E^<=18SLB2Kt ᴉ9Ua s=S#RQd{r'QCaCQ\vJIBhAA!t3p}Y#QܸDgVOpU$be ч>8Ƶ" 12HN :Hր1I!1Jdbt%fhZ8B|.DsD"J$ KPs9GQp68h0򺲇^8_ (̅v'#˖+'5!qg.p YMqm a½9'iwo$1g xk P]:ಆ%wb:TAۦv="Aԡ??V ' eR}7z \ߚSGRߧ[u ݷX;H=qm˲'Bd˛OX &hGo]]$V`q,5SIq0Cx  Uf;#5~a\.yQK5X ^vTPS'sG;W|[zG@b'Ai) ?:.wl }I;.=5}I4H&JF,tu14o{r*Bx|rNP<*S݌ԧ ݴ)ȴxNr:M=3H q*Nin_GPw3H^Hd+ezᦜl7 mO o=)J]ک>q 4tN\{zo}˛E%ni-~i?>>7KڵקJ~-]zun3#K}ؓj_Lz'`O֭懦CmT{#Cח`=lؑo@}l3Ul.xaxRM.(;.%#Af+l%_?(h_Z}{kCV ;b[s܋g=\ޙny蝽g ms7< -V  g.[ݫL˕V>%VmnWmZwN iN;/q{p/fy%{KOGz^E}>Q_x } xC=kzٞ_3ku_W~'mwIۡf^|e%╝wqkr/uf83tL`d`e| XQGR^Xpa)?{v'pkGxˎw#"}^s:ȌjӇO"ƭZF:.9[g Ew1G6%Ug%5N_\uoqN_ 5`2zYoI#=?9xD\q5__ E_og1݅x3vTę},>Š=?z'iz?l¦ endstream endobj 18 0 obj 5401 endobj 20 0 obj <> stream x]K9r篨NI@h@nml>,|w=0Fv.Mƛ*=`Ç`$FUڟo_o{/;+{[V\~η?[hAء?#][VRꍾnV(~+P!!gs8x,Bopr0}؅ mA_>.K7BBwGXPcqL 1~8k.C]c]z xCnh24>Ot<`]~w~mAA}Lo,|KzgU"a1!TPDc:FfC3x|x"Z_P6'hj[rL\m4G|%X yvy*>Q 01 c?8emRJ dY6](x`xqU+d Mox& I`W#eкw S8F VSes@! Ei{&tg| A#|X+Aodb5X]!`~oeqA[p:JA &7"xУk]w4vq >tlv=O֗ yIy4j><43+ĄBBda+Uy+EB1U`f%눷~If.% 6t̆(dV $ ,O< YKN _0R5Bq Z/6 .a;<yTdm@;w}Ose7F/'|C;oh RG!Q U{.W.U.vbe 3=1v N"^Fx{EG5OƂ"psSs2 F_4鰷(V =%c&ыf䚤NKTI'0Z*%Ӓ!X6odV+ 'm!; ĉy F\DV"+jKFp@hxǫm`zsx@߆S% Q"qtGaBGcIV$@aQ ϓuTOl bHmKzAyGbI_PA )ɂq~ib#0*b/ ӄ TZ0c,Ϣoml6/:B46)W 78:[Mx6a{} S҃IL6M13')]MLRܦmR\%n6!On-TXL%T2e̡1RI|la\ʴC-l1x(q*,M5kѥL XSNE)7[(JCq=ݦ 7f7 ؑhYs&uE/32I Ԑhs x@7.rš |z@.hwB|@o/H|z\X? G0|ADU1|^ga| d8"-M uQMU`ĐlbՄm;pӛ>. aAflś@Ty/e {,5qQb W@V8+O!!R"p>o,aPx띨-<5oeA_*4b,ufI qBu, jrx=UJ{坼Xp%E;Un[k~Mmx !tQk)3ls@=-HiP[ :1g| 0bwP LM9Aj/w8xBȂTO75{ `a&`as!^VàaA&]ͭcqћ}z`  .fhT%1qҺeܰ7/JU,4 I6Ԃb&TMx[WjAuzY'![!Y!^"vLplbTv f@~KSG,Bt@}v,2>2!Do-2Q ĻIP|S5 ą  ?Q *;шP+^3 j>TEqY3mbj%( B@xBA2 X:&CTgY^i^;B$meıWzmo AN%b) BBUu'F\/IZ%LL0_ Ձ@8 O@ :}zЂ"DR$Sbaˑ+f㜺R~UUl E o`n+CzJ дs D hwNvB54|/x k*T:06(T ,-"1BHɌhӂ-$0hgZФ$KrFVV6DJ.L=MuiRr+A=DjƞуͧPن%yV+~4ʿd5%;QR,9N!lcD Uj Y#!sP'ՉH+F*U00oI)W/N!"֏4Bt A;pf=nFpt@ބ4 Do{S7^{ê1m`p:Bs%BePT І@CDV6HG7'j6BcCx獡C4UFU(]TB8r=H2UFXPTWD}% MV7}+#~\ QS` B9C>1vBs p "1u(ce_>PSč64;r j(;IL5pE^ttN(>9y ~:|*1"%OI,Pi(<@!h35&譐tK7vh:T@A.!Ujc6.1!dIue$$Œ =*ުUʚ3`K-9:ANGzYvLtڸB/S/c*Ԇ\RLj krIzᆰT&*/]ˆ}vXM}~~`%zhbPh2.Xp0KrcJR4J_HDVw#O/%DCMN~hjz Yi2 M:!jLIEߒIu=JW4ͼfOƥ QKBBg@4 2o*ZQ^Jڇ:Y}`%lun,(:읢-LO+kCD.7t &V<ʗ~?|v7߾O?}5PYg՗a/O{7wrS[~<>{yyυ*7IhkG1>uyB- #1a %}pnyxuwJ؇<ԟ\ %}MrWտs՗ٻYF"4?OHOcab* ϠN+&}4gtrwEIE!ԟz9i T3*定+>ԻoV pwo؇!<ξ,zʗª1/u,Hg:0̬;f'2Es8u wEg/ hiX-}~8=~ȸ5q.cY.Γ?F>!§$d6qP?A@}uf0kؙ/\k 9ffuSsZ^֐tQv S?UXuW-^\ {dJYNQ1$Byba?/Å;#W2.Md4'VpǬ!I>c!qCPXJ4 NZɳ1S3PX97xd ї_u2 xQye{8^kK`ðk\BhcdјEӽI1pXȰ4M,z3Y03k?ԉ<\Z1wxf}յ;U9Hx?5 [Y"?ځ|VXe)IP_J]$4:{5Clօ0Wp_4mެՃY<ۼrնZwxYSC$z%q/õjaT*q)CxRuU[qhf^ȜymZK@-ZWƑqc3o5#Hy-C5'NI~F!pNv/ L9[PSߘ1%Ҽ1A~c:#g=*Qs;x:YƌvIo􌆎* V35]o+G3m8;CXV%pFr,Bфc؉گRA?MEw{?5""z(:D+}V#]ǐ15ޜ2yg2Qh<*2Y-ݭ^i麸zjj*yd$ * 9/OE2I0L`!B# *L)F32~x,.gb-K&_?Lyj^g`| n*G%b*e؏<^9Y(5`Z+W&%Vk?r}i!Z,&Y;Φ1̰Ķd~ls:pL}UI Wwl~i&^`D:|nZ5&4rSҭV~y_ 鲾f=XúV'^r30v>Jyc a^Qib3kXW%T>"~ 1!/dSxd|ZEɷvղ!~`Ɛq}WfKS/wc92_ta^E6Q7hxgȸeApq}bGva=΁Cv"LKMTȖCz$[8=K{ě`y\EP$`ޅ'P[ oZ}:w>H[j[[zh[ʄ ~h'LH7HG;'o_6!Zjn? ]^JK{#QVDet0m04a#^ra/ M|xLjb>|ZPZ<^-Ի_й=|Lo\yKz4DDvƤU1HDa^R~<|q5_pә#p<|7sy0xS=gL)9\d9^M)\Cp nr8rzΥyr/ ^͞; CgWg+E>F=w= rj?R9;gۉyxb?{j XI_tföa7Tnw? sL4ϧAYsq9)xzdq St0 ^TGh6.=r~jGFtgg~hӄHϔQp/m@Aco˱|I\.ȡotpqH#devMub+Qӆky~2&vXӦzQODdzBm+w'BV>_TdL^jV= c%EK;Z bLoiAe*I0'65wLsZcE//{ݼf3 s 45H1b?)5~q? QxS endstream endobj 21 0 obj 7063 endobj 23 0 obj <> stream x][Hv~ׯ*+! ~7z03}+Ycòlo~)).~P֮_om,/_Ro_/?\|]~^~Vr|.Tu<qa#|l_o=='ueqqp~n.?Ggi[ }J-!2<A MuWۘr @ELn0hnmC`\5u}s _Y<;cWke`ZTi +%Ac 7H0\uܯ 5줣tX0 Os @)x|6DZ8 t% pe HwA6i Dt! Sv;T:J`dzg{:|wi `7 po* [,oj蝛](f|HJp."@V;: yA~l +?yc!A c'K훘3eYa{&(Gb쭩-],A_7  6 Qp`mP| YA-2=nC2Cg 9!:O7&2Ü`\)d씉 KD+f>iov`6Қ dYst7$Yn$X!mdJ82^5)g?IM uAj r82X5 5-S#P,-h :0D (|EϘ]ٸ D{ U{iP"C]d/U/ĽA~JSJ5B~k= ~C#e^Jd&h)b(J<Z^CUt V2À` _J,4@A H A" +D@ıNࣙBK+Ղd|I*B -rۀ*2!#$4|B>_ FF'j K|mB),2"7ATTƣFZ>X J -JΖD6426J`KTW[WK*+(}BODB@~BxNEH=Lm (2L:a958SanaDQP1oҹar]௷_?-6waMm̅6p(arqUn%O!2s] (! e' $iҙ$ŧ)9) j)/>5=sIS `ŗ J.+i| S M)_nBl*Ѫ<*}JGݧ/7M!%ҕJaS$/sl kWrw+BWoO_ߵ$Aۊej7ߺF[en\st6Ed؀-sk暶HL:nJq^u^]Wk]탥;v]2ӮӶ=ұN~9>A e _ \g0pbϒx1+¹86fyo33>-3%9Q3X9E Sf84Ǯ-ws g=- LJ{ 8RKin-$\B"`?/d 籓},,eJ ,`fg$NscHK >gTZDcLAfCv%$+DX5 H\/LiWiU狯]Ej u)n!?u3FS$ӁM\7)oB1Nabjz\RWѮÞ{oו7dem/g 2\c1p8ǖ@rro@q i^r~X,1n̔^P%Rd`QV(7,H+jlk>QWǓ@K,܍շ^Dc]޳<T  % X:;Z~X$+* f&n&Ln*Cc+uzs&I˙Zцghay&CKx0z7wnbI${yQ[ ʍI:bm DAq' ܸy4Ϲ9+w`~W 'KDSR'몺j^~hN(*M#*[JSn$𤕞uʦ|߹[r`NSvJ7 ZY+ӏG(+ݯGcy6OiClAoR &oj]c?a[e!ʎ@˂DafJZJ8 @z#P,<#,E@WJvDQ Da01.d ^77Mf!j+c΀R@ޘ; XБd -`:OKŦ[IAtX@\) (cLW!3$*M^$ _ج#R%ƊcjdJ]Dr61^HQu(L [E'ɤ98)!c(9ف\k__'əg|t2 Џ9ZPp@#ʘdžg_dc@$~qقh z(qZ D FH^1 z32Rh1b* !Zq6:="1iRd#4x"ΧQE|i-1Bg6$Aے964d(}:3@sJd Iaј*a(ʧD(hj޷blϋ1XVTzߡ7; "yx"U1 BS|Gj֨Hģ ۆV8U-xodmŠla&1r1-;ldۍ\ʂ + OW8 ~&I4iI&b/ILk/HZT^#R8GNjnҎynSPMJE<2(4FTm3{t H'\ͯ*WGMfDvڗ\Ҽ@To;F +G2^֒1su#ījndŭQ[̝63 J0#(Prt > +j_=Zvϙ1<( Nܝthf$PuU27`xj1A,K4#ƙd[n0B9}Nrpkɭ_wrޠkNUuvvfױ5~5JcKKLv0/@ z*(}'ioQ`[[5i&?Ƀy-k]/B‹`mӏ_\)}~ /~^ۧZgZ!"lH☋Ś#-L!W۸w_L/.gimqJZNŸys`Jd)Eu, ʘ YL/yp}.뗯}j]j I3IMvʂK9#{c ͬrHw涋 ( VPU8YT$ւՠW&F[[w JN|l[(G_^ؼ[1$ L%[/r}Uެwy lCOGa-a ,FŴo)N.tйHhN.2h~u7 2mlxgEhc>ܭ9&lƁ@5#ݑ0|8ӿN Ld{r|ƉYLR+ozr\a*YEݯ(yJ |Y<>^3qH!5PV8&M!DuvcT:%EvM{(0}޵`L%­3ghregIt|lAźl|EXa0P78Y!m8)ѽr簞cΐ>=uZcF%KU='pqB`|Ӟ!MF&8h `%8Щ|y:T\P| ̧ *(>C*A>I_28k#$Eڳ%]ը(Nu)e>bmS-4t gƙ Ws 1'L_Nzk}X+^7DtGV?iRnc|J|{(qJ+cWHMLK gsA6S%]F&Kv:p#幗C!qmWjD?2~;& Oɭ0b܌pWH?ėU4 gMltCe[|ħMX3sy%/9Ƹ|MWgڌ<#bUR?%L aJȷ#͊K3 fnpC{#5q^|=cݿhpA~+{=e8j #U(qĊ7Ug$mݡޫNsP" _l* 7L󟞆X66wrPD7e4vQm\njGxv}OzB>&A5JbngQۧp;XDՋ)Nk(9` _Qg\@7=,Pty1ʼnRJk> ɱ =#0$[}m ` ;ds:hQSAލo-wވCWDѻep8\hSC'+^tɱUÉuoky[]QYm{4`WRdQ!n'LV3!bzOh\CMbFyp{{Lʹ՗n7Ngge(-ET1;ݭpab>Gp0D8Q>1BEc΍7|;sr&[ D}Eex"fs zCӉYK=|e&s^|<{#!rg?R;X+cOoZ鋠2Lܩ7VuL.1'MX(U, x* Y:_YeU"T"ƤJuPEa?p.d]3\!*7rotH?򃑘!Mm2żCaa͞\eV׵7G tYctp-# e{+=6oC=֝iߑ#5qG* B{*tZ|ϼgt)>I7C|?cV^JQ>ɇ ;ZL}O,.z(E.CIɁD9:;G#š&^ !7Qzd5 W|dzb-s/Qn~DɏoɣHX (Vjx>|Q_N|1|[8u้n>^+Nt}.k*S_b":Ot^Ϙ|4O endstream endobj 24 0 obj 6662 endobj 26 0 obj <> stream x]Mo&9nׯvJ0`M@ ;x_{z6EcbUIH|H<ۣ[uZ_?uMǼ1=yaft/%?Ƶ}_J魐u-;Q> ܣ C񱮿.5E .\wNT xm Fk,:1.`%6hщډڟv qLץ5dWZĀ%:1zRc'\Bo(mCƞM&ۉFC auzߘJKD3Ȫyh )&!꘎!-!%mLo:J%e&W^(L,8an HĈq3 _xT"+"bMFp@!_Z4|`AD609 Q I\CEoC)(Vp8z"0#^2@MZ >Op|p~,r $cHm0e=e&cRɠ,' Eh1u1ZQU6ͽMSVViQ292ŭ_gA}_f593JbNָa㞍^C?)L &}虃@&!nз6TN!t L@ Sh7A_bA>Lb10efmL Ydbr06S7ezC72)לPOwiOλۇL|ѧ]J0BL_Fq^w:ȡB"CU[J7sZѡ$C%F5UEŋZL2S;jRmUL}nM5gꀇ a&3b } mjV {ȾkI74u=7B#q=̒R0 B[Ȃ 1'ĨeUZm` oh2]|R) k-"WCP.0!E69O3mvYɇҔCJr]6fCgr;\p#F{Uɶ)'٫滻dNa)?M V,0KP!jBTšza&{*Ⱦ:uL][uCpћ}`0 DCt%U("sA uleyTM-HS״y352B[&&եeylds{1HdKۦ*QcPB DQȱO[cYQj4ˬBtPjI8*YFQ#ʧF8'j`ͱ  )zDTJƊj$TEHnIP3ftJU=J ǐV`1qD^9fQ^ uv @$2]"`$B鶷DzAIы3-QU܉:%KRޤUHŔb*۰ާ'8ξ"b1%{928T]Ukq4eA'U *ayJ д@DthONabZVKbߋsx.^N)PuFO"s(XF_C"Y"h 'gl7TKVt&dgLDKJNx QwᚆS x+4K: 6(&@z*R"Qtd ޜp lƕcIT6:P"l+Qd̼}~~`{*|.-DfBS<yN8%<$lOB RvАhrbdP6 kK %(+$ts10сLؤ."x%J89sH{bTIؐahsz([Ny&PgCȶV9Dd]!Y')52Օ(+.3S6Y_m>HI2rGީ5I9:r'6#`Ws'mM;=jju0#?ЋD-1E'StQifE;($y\5H&w ;$lϕS@$^*#.§NA t&q߭7BDDDSj_Sq LTK4%˥TnVqUh%WrU$ 1t)(ƠסHZLW})qE>EhAѺTΑRe7^ S \m,M/&Od^@>uia w\`U@S,AUML>I4YreP3DVn35<[" V2h :T@I\BD%96+Bm PAQMJ/6.DI2G]\-I"dRI iLoJ0&B ?7RKN4^"t/iwfbj. Ud?T {1/\d!%]v8H = 2ӆ.}떷궭Βkγ{ݟ/nsof.a` -ݵ;}~g xx?Cl ntyd!Ta} d_νnLҿTv&}y8;.Bƴ CӴJݴ4ǼCMuOu<턇[mӆ0ldӵOw4B>QR}nЦ:zzHj+lAx=%sZ7(}Gg܇g3)C²MgJT:w7Iiѧaat`g؟RK0j9(aӫ誩yA_t=c?w@o$jV?XŝT칔[0kzJ98CDkx|>VS]Y>}.Y1YHIN&[%xJq1^TV]qUDd7^l##ԣ-w7Q( !W1]jzaǶ0Xz|fu/]d'fu%/uؚ QLĥ)ɵM8ZEQMP}Kb)6o2ݟWW?n>hfr9:yb@QCYyѩK "񷝬ncvgnE_=9~bc”O=e7r rGnf(le ß?2\uEsU=,ȇq.y+7dS+ N#^q߱8u߇HWK6]Pܛ;O}qxFڒ:9s?݃pۅ18|G?A7* 'G%ӒX-&6N: 4U!y1 WS~_/?ѓGO~^  endstream endobj 27 0 obj 6991 endobj 29 0 obj <> stream x\ˊ%IrWuC儿=HȚҮDVҌQ%1+`h:;ND}=[O)ݾw_x>n/÷[ێ~+r}2zL.(1_~F~ui9<aDF4KT*ГD ј=38hFăq_jz}2YsLڠt9n ʊő Y# :J\cTމWA̅>Qq]u̕ rV4LD`Xd`vz|<5d X!0O#4)E'G8͵9A+IawA#<@g Ĭ'u*H򤶁@'@d+\wi4 LyKLi'#K5 $wO 2F`rtZ tD x/u݃a#*iETR f1 օ+U'4e'pX :(8@U :AK3eŬaif''`oݼw#lPՃf#_wpU`Qfц-OȐ #dQ{^cr c1oHZ:QG(pm1#4 hGGT*,B0km3uVz$WBa*i:88ġ\.!Vk:T{V>msT|qT.L k[B zpa2,s K@| @lՃe %f֭݀I7L7nq6uCjuk^6v)pAXӆ%8%Y% r )urIUXӭ%;hͿX?k5th8n%u )vIr8.^RE黭sMׄ)HX++©ܸ*De-i h).ʦ䀮 p.͖-:W-`x`\JWqZtRZ.Uwxù^*m_[mRɇ\C8\@{kzK#n%Y'KgE{.K7&4ҿY:nu¹tE7jpBk釹N-ݵݖҫs=<[~afca-) s}֒ 2{$A츌b_ `ŝ\I>)mnATOp#8!J8T!E޷XGmu\,E,"K%0vΛZqͮ#pŗYuYsڹPH芎5^2m/yX%_rSR98UqV-K5uT5i=TZU`lٖjn7_8Յk* WW^]*STj9,uRak*g=&˩տkC𝇵#*.7GXz"KJC-η~z@qfْM™H˴K+2%Gp9!풬Drk Wr V@0;. w8'Ń]F'z=C@{+N0+ w`?{P=KeUd!xrZ-Xw7 -W&[qRYԵ&r{{8,|sm4pbԴ3ޤ-CJN]RٿwtB87i:l&r &six.rҤ 7f#wED%]p_͘ \T ʁ c{M;OaLc<Ȣ`'wHS pV0gv9p.)`pH7oG >6!fͨ%kݬk'b4hdԩ8^mX@“1Fp'5=o& xp[ArĊa£~I;+jx$Oˍ,hE2љ3^6? ]zGÀ({G0IF{{<ͳ\Ǘz^npE@AT7Bh9q00Ct$@ )U:vXXA; 5*4*:mfmߌj’vj*D&d' C !(U\WIJj>:^Ovg4*ӊQQ]";]Da(B2M>Œj/F |Sm96OlA tQ'Iz,pjAf0%B85r#vI%PKtihxFϧ( A2?Z[7QkA۳;64³c2> ؜2!kpgjZ/4aB@ Ř#xy~lI؄w-(еkLD4iK) y{Y)Uy9AǁӊFތ;V.vmy @}xa~ qbQ#dZj:Ӷ>],lrE mܤSзU5Y>(Օ\c wЄMJ`!*H~E]°ZF$|N {Y y Ybø"Cb"/_(샼swîdCrf9-DB @5 0O?p& <V58-p=Tn͒uk *(6 4gC6Tвg`Ce C|]uPtݙXU%>z#Kꚨ)~eSv*}0`1P-WWs RINpZsƳ@\A7jqn@ejFP 'ԲJ ^ro (7!r@I\])U- ^sSJ@KN8kZ(n]㎀$@E6p0R5;ﻻ}v ɾdVhCY L!Y-|}au6>!|?u'^)Ccy})Hf~ C} hu[( $\v] -x "+n,:#|y,kst"]>U5ȯt,Mǜ2 em0"^-xl ) j bE[wt}j5E"K6#7DC4RAY Y^Ut7"U w(Pm<fa6h&aۿ(֟XaC}lKX 5cz?n_$>xzc2H_܍~ #:{SfoB߮9Ygi pWM!} n'6C{.L;[Lڽ0KyL~Q ~\g>9`Me1'qSɛ\wY*E|z"XT.?=t` Qeׇq0mv{5ىQ}]wmp_c m"fޜ]Jg rET͂S[sFX{d8s1}"6ųDUArhꀢp"o*vtZd+- O>ޝy{_J뚂&wFTzU=gͰ\ƴ]Ѽ^?/bԝٰ8+M_N7dq, >1ُ[ư69iuX.~|"5F0Zi#8*QO;im|Ϊz%Y*B2~S(S'ݛDyCr[6l\ SV=!!ZhX:U|>;_ hfzus'rwHn}_K++}qH7dCs!/wDJo""Mei)2Ď%IB<ٮi,ڜ#}ps6+eЦg}n7Lղ6ʻɘ5][Ѧ]4YvڻĻ`Xj~hyoV LHJJw.{i'PF:·=܈⅞2zߌz]؁b+;}>O92m~0v1n:] 9>;OK6OlyU0z:s"'A>c\ܱ'2F1?e@Q&Q3~@}'׏9=0*Jt{[ܛί+Nbo۟~H'n͈u/|I*я)IUJzZGߺv NWL `x3hD;Or}ddޭ4> " endstream endobj 30 0 obj 5192 endobj 31 0 obj <> stream xXׇ&biFSLbKbPcEl XĆ.5ƮQQ7TұM} 㰻.;wXg̝;3w=wvvx                    SWRJnAVFxI=fi-;KDKNgJԷ̙ tޢk"YEԩNQ3|4teguzAˠ\Z?z0^D'a5)*'^З 5qRsuA5^! єڛWb5"No]t_ xE/ iZfhf^y0 m4[NWZ /R]7-C犯a0%|_Ķj8g>,|f&m+^GJr4iXN0h(]|!>:K8hi!I1(HQЩ ߿ MxIH+Z^m[v\ qqG#U;Tx˕\ye2#t(]ԎD͚yMh^NB<{ }F*5;=NRU[QKN OP e"tC_Jj 6ئbZU`*5jYۄA6xͯ~mlH _P!ǁ cP}VGgb .QsYZM[j n{ۦ_j*!)E {DX5ᣡI4n+BQ3@gDA_hTj|ʨiP\:ݪm/ԶRq                                      V ADGf2vVлw}ϕ 8fpgl؊=) s~:H.ԩի}%0:pIRTۥKggg޻Hm۶m4׆ʹa&hQF/hX0iP_D=@S1}Nx'KY^J.%$nݺq*U$HLLLP"EDjjjt*2UdqYWE\Sq]ō?D.p L JM B:ZZZvڕ)"r1ڵSy C9k׮!Kݱ %x7TݬY0aB6lxN1rBXfٲe(pLiiixr7n0H+01ĨR RGuLxwɉ'¨X~јsg̘B|p͚5Z@o7n& 1;v, =<<0ˇa"}jHr@>:IJJh4%d,eUl>&N8Q?'\;-DӧODtt4{h$6cc[ϰaØN1p u]jժtD l۶u\] a`ETA ?آEڵkcy-Z tc2ŋ1Qzul-/^,ޑN|tN[BKWL:1brAanݺkseDʾ]ЩWZ˭[NG"/;E}^b^1"@$8HSza$^L;~q%޻wo׮]a111U?===U(433^6'Mt|rLbyt W 2t*dSMM {ѣP#C#={ F6BGsڵ̴X6fj]p!P(0~YrI4tjzSGL4jjt1~hh(:ސü9z>jnzڵkWV`*rA9c5j /Eڳgz6!ޑN@ҩ39< aT۶mj˖-6HrtJșSC:SBΐNut* )=X0S!rG0*S!r nxNut@M ;MƦK.0[H:B:LhSWShO ҩNF0DFt#S /! !#ɟtԉ"TGH`GR)dTBZH:B:xVXګW/޻HS!NT ' SB4iR!,,XR}J,ISAuV"Jj%xGݺJBe8 fcRTm[6tzR%m!=L&R̥,JZAR\G:%B\V^MˍZ5s5UPyT*}WZPo;uUDr}$RK o SEY'Y$v#M^׍ߝBaS\}T..~0)TAwdaEA%H&us){N)L>1*`A:0}HRK)dS :IN)$.BVA:_D]{ >W~}Ľ% )XmQJ2 ǬBM{S^6줭oRmLa Rp &CCt*I3m:ڰa% Rp zbFѴy7( ־Vү,UU§L'B Rp JddiPx3#tX ~˖[ô>>l1Koܺ|9ĉ=!y>v ,}zZ@6}%,yAŞ=}sD{N)8 uQv-+9䄗/^s«*ܾ͒ؔ%K*bv%_~+V*:}$Lsvf+~x9sr򾯿~(t)ǐNoߺ"(_fgϛjU )^boķR J"/fi2o[oN׭}Zի-,XmA(S*e>g/NW١7HC.:ξVf&J0xN +Y1++Vᇬ {E"y憭doZy:^(BN)8LtvԿiS(g)")4+\=ik乳Ja (8qw3R qQ#<Ӈ(BN)8R؈sN63Vgf4XĻt "BDVTQDX6RZr?,[\I}g)Jl2pÐ:S -[4Ry3"[YY¸~܏$E!uicy,E E`^L ~+D)< <+Lݵ(8`9: R؈m~ +g* Zmg54K~j{h ,\gl^J佛%=R}+]ÛS#da$?ҾȟWq? tJa#03~POjuQiwIjN?鍿1G7~)E ʿG"~ɪ:˻:~i@T~~)^Sѭ-^ܵFʦbx.a~K~(t )EɫD|{6kV9_5[jM \)aT*@a RH1G$?3@\߮W^/ mRM!yN)>0{7A"H!2 H;WZp?+Q`#M;xİ~-e%v^Kdk憖-{7*K؊1w#狟wt' C:=&~IGPe)ʡ-aDጩ#,,,F#3"u-űQVXlIԡ !O, a35ܵysV-Px_:]8obz6?yq/1,-[ t:kxpo"cvdYJtKbL# ; $6]N1"Yez> H?n}%LlԍLY_u% jy ;oGl8abɔ ;Hߒqa7V ݟqngڱ-֦l_iAيE)8-asq}v=֦uVѭG[֏jK?F!IvV-aVQ,\F!9T) e - /bb=ij+g )) /KLΧ)tU .gN q[n1(J$G:^D}ڡn)uc| yniB)N^;/#x7;SA}v IbX^شV;,V^= UA'}0vcs4:}9aլ))蔉C}ydxeJʪCJyER6.P`BҌ cǻދ3ax_$NvK9R1o2%?f%qZc]RI;YVz2OX6yݼ$1!GG$Q^|Y9iӌMS~9uv6Q.mR_}_Shg =uRgp1cH;P%z(:t?g_*'`ݶpDNFwawgv`?ĀN1criC۷ypmӦаv]lcn|&Cm˱R_o`8m)a>ʔicdK/~A1`\yKU]ZBX?|/~d>OQ-X7EkYZEhY}^:V)_DʽCr y{ u56-8\mٴ1BK$$4Ӿ9\iBKpשz(3fQ.I^37eeT_駶gɌ>bHqa7c!bd´A:-_^͚[Y֫%<2$N(0ѕ-H¿4ǯ#~QjW ;ZE)sY\QgxN&@/Jӄ6$B:-(0?1I-2ueF߷f OپBZsRƸ%HҏoM;)uZET)[#P?tSEFqW%j|Xr5B/j5_-aYIRDA:ǒK5r.)GGZO9=T32wf [e RI]jv~Z ҩ@#j )+#31@yӸi⬑[% .mȂSWFw()U?>ӂCYlD?I3sotJQxlZ(5)A:-<2#0a,tJQHd {jnjQ}x7(N MFv~1/5V6ҩ-@:%4YYYC:՝ժcfMm1 SB_cm;SYea!|!5wo͑).]~P&!Sӭеc"jܯ ʕĻ9rtǫ>l˷nN 5|!;>w[S9RH3%l[ݜbT/4n,\>̻9#C:ta ,2eJ٬ 6DDD5JzN:uQ}*LyP):nN1t:w~:uNΝV7&NY˖-;ru֭[iiiUl )$}nN1t1G6N:4xaÆ⥿?f͜9sڵnnnH511nܸ3flݺl]+V,A:yѣG/^eӦMb^^^SNe%h,dǖo1K[ƀt/n[ϼ"1]U۴i^nٲ/dbz„ pߧOΚ5 <111==ÇL:P(n߾ZncT<{lҥ(y?>`W̙ %޳gFxX)(tu#F`xΟ?!;ӫV>}:8u_5n$H"|dGluVݻ!ՀW 1ڵ Ǐ4F 1eX=ZulBm-OOO( *RÇ:T-wČT_]P2Vlψ&;vRJ)S`Y%[Ksu-1⪺#=zMPӧOϝ;gؑ.yuKJ/H\luL֭[o$߿$6l@.:0`@NNbs4իqqq /^f%<BxYN叼| mTPp1bJ={v80==]-Ztƍ{ݻ͛`f~ʕ+gv5 mmͻ9ҩw/Ww[$F:5C kr…@. #d5\5k#A:-n6ŅwstZ?>11-Sѯ_-ZXL&MZׯZA ggf͚tZ4jĎX~+Zlf%fMrЊ]#Zj߾}SL#Һu_)*Xdjyk׮-q}mժUmڴ^PBҳgO EoܸQ .d +#`r  ( tZر 9}D?Ҡ]vSN-=}cb 0F: 7n02dȐ͛:tHЬUV&n?~q6m[5q|ܸ1^=MYY')^uy;wrL˹so߾v*1( 5q{qN믿8f$% &cWztwΓƻrL`Idm۴jݪ#OбGc% Ϲ&2=&cV-M}_6mڸu lbHtZ4HRtOw.BI\!@lxkOVީc[N0zl,{ŁkׯlTZY5e Etm߱C-l7 l;XnA:5=ӢA:՗SdG"/-H}7j2Dޮu ҩK([3fMg۷k5lcNMhN$tEǍk %P2bX?Y9 t ~6ęŔØN!O$c:?SaIv)!4i #dN hN$4>PF dF^܋IÇ`V-fGmPc11{Dr6mZb*lN qW^RQL܎%z9Ū+A~ϙΫHEt/%AKŦMիW5k7nd+V0Ad~ N5L'NC(1c+9sP8ovU<}w/ ukxLRu]QǍCߞ 'R㏷oƍ?Ѹo{vAb鸽"WTVouO,=ٳgnZ_!ANƒt*P߻w'O<|fC˽{vk?WvńV7:bEiTn~q/>1;oqƤ$ϟrF_m: ق 7}Bt*H ;{jIn;uj_E{}ĞbU{w%V7:bEiT,$hpKZ`OIлq+ZO+(HLE`T~v|ݫ7x+q>D\"{܌7#KU.zs?JBt*HM8s$:@XȞݲ .*IRaŽQ(⎥%,҉m!+NGR򬫄.nb#5HzEٹJsoLB1<;&12̈JYý= )^}64W$SH?U''}4A:+20+]MR6-9T1Y1#wSlfQ1MN)jwJ\.# jF}{vL~{cLS }#~HoN ZYSH ;&nTA:7oT {$ sA:U? K NS锢:R\%7H"XW~锢H~z˻ z#mzMSqZLM,S锢hX4Ix@ ]3ϡ "3DK7WD[$锢ȑ0QKÛފ4RN'E߷BgY=>2qN) B+R#?pݪqUw &w7+U)q'/4U)jtLݿ?Z i?0^\}[42F͙GMjGcZN)$٣*WR*jlg넱׸ze%w}:ͽyMr#_*gT %63DN LTy$)6 RH駷R}9 |ktl8nb޸5sSwL?53ާju :UF2qN]qSNUgBjSbWw<jGS C=;م^!^-0JX!aށk|~R={Vf9F$N>Ft*䜲eqUi7e2iR@d7|ro(dyX~8h8ɫf`b@<?WS c"0wE>1Mÿ4l"5cmX~bH-Q Rojdk~H48yLel2*v {;Vl\X>=}cBF^L:? =(aRJ|Ž^QFgwi )"8$?'ڲ~}784ktoTGh9iT? I$iƹP%1֮mG|^,$EdlR"ײLo. v(JB{tJ=2Od\؝qm]~>ƛ'yc75Hيgwtiw_ Y9EJB˖6akz7\gҌ~ƝՓ4g4>& iXJ3a-F8t(y I R9_Emž>qq/ 홼lj$7 aM0Ih=Zd+at?EqW(V >G}nV_sę#$-X<c2y=ŢIaU, A:s(oM~aOAylZJ_^1d~m롗;k;Y T,YY1Cw*xwuSҩ)tJ!suHgͱcl5/`"QL?-^X)Ƃutj%vk6y~rf{UI )?zEЊ|;aTRW\bY4Oe&36>$i )E!qADb׬v,65s ~3|nF Edk锂p_0J?]M1M G ZF|V){JAaH ng2}5_]2.]_󞙜vxS>ک>˹1\glrRPH CQ?KBߨ~t~ %cmZk>݅댭ȕpY I"}pSXata1T|(R]$|>l댭=.'N)'F8 L聒1M\/Ү4u3^྿҄"0U!e*͌Tܕ~Y2~:cq]I J9})($aU0mƹ9 Qۥ(! =ʥ,/%Rn8*U$PHVG4"2Tdfff⊊y\Szzz.x!ĉ;*⾈*Ʉ `=z>'> sT[[[$$:W;:888pYfM>H4hP`` f*+O @hp 7"-[޾}w ڴisM#:è hP \'''޻B!2)Xlرc zaN y"O޼ym۶=z4(! )!OSp {{, QB:SBVt*+dS''={:::ՋKNut*+S({fڸq_5o޼nݺcUJ8S] :H'Nx qw;vب}E*9*,;`O>UP{%f`Cj /AB$)zו+WJn߾-&xA:|u w{ݻB$xo11bĈ1c888۳BussbܸqP&е5;;;}uV, ]x)l.fah.L׭[XEͧOK Ӌ/~&҆ L24|||@ydd$g׮]xɓ8zڏTH7xbŊHJrϞ=*U411q߾}*Xȑ#G+CٳB 2'O'iuok'xqMFe˖9xUV~ʕ+ԩYM4GW/?Zj;Xlڵeʔ~xz ԧ~_(D7jHNcp8#!\|CMN===ك\odpF(u;P+{jVN!CL33,4:?G:sLraoSdX'A*iӦMq1^:DtUBʫ0!Rɓ'.]([8Un\p!VXڵkm'HP3B*UOb_TF:|u *tZo߾]`ds#}П‡0^"5K>eؕ5Ν;(vE!CثV44iӗ/_y)foN!aAZ$),ǎ*#""N0)FL N8D%'tqϞ=U0i۶%%Xmg:]vJ,T`e˖RTV)$U%$$ Dv7"ut>wda쏬/"f:EF01i$//U5k`TOe\\N #G^vNQq@H:pz꡷0aby`U U"H= %$(i̘1Ğ={Į]BCCN!&M?6qEvt*+=fC?Gmܹs7^~9رc1 ߘpTSs̉1cgPӧOQW^4hOw~B!ԉ<6**jS!N1Snf!qtٲe߻wq/7*9y$ݶm[Vʕ+h"Xg~p˗c.i˗/Oyvt*+w atMkF(ڵk>H dA:Kt~L#=]:HOOg-L.Sn:2|^͟?b_BYXW͟ 6 #+7n^㽃LyBXXwȑvppp;N0 ˠ/4uڴiX]`_ Hr4q]qIVV4(.B1JWlJžUPUV}p8 +!SY!27K`*9Poُ{YUj`.+d峹GUBUWQ?b~KEHE1)>O"q=rQ7G:)A):-Zre\\E:SB_ҩ t SYA:% TH@ҩ$THdڹsgǁTNut* C( #A:ҩ| ѩ-=-0S] h"(N TH= :E 4'TH2]UOHS] SS[[[zr2!9S] Аb:uDwLC:)wQР$:}cR{FS] ҃ ?J+,G)AH&MqƤS^@wblllP=_ (c6.euVAA B 7f9x.KO`CaN3H                   Œ endstream endobj 32 0 obj 19339 endobj 33 0 obj <> stream x{ua,%4.1tq0&r!$$KSᅱ))1@%8`y2Ddeogw!`gT}>_pvoΛ󜳻Hދ{HzօoQkk93̚~owX("ksšB(*fZw޳h ܰR[m9quK\~~OǮpyXtj壋+bߚs(O:bң,%P~Lt~~^xGrt/?֣PjKmw)u|?;p"};7fiU~9YG܏~gx~SoT|+$u#.Asˍ[J킫2vavM7ޮslE6?\8߫j>X9hkG}۽ަN(}V3[?3 7MroFYƘ5bn}6!ӏqwM mavu?nէڸqoouni_g_ 8G~wo}.-u߹l6o>_̄9Ǟ mYd}f?Gbv{se8/G+Nom.Y+Wΰ(l8yf wʦz>\{ZeWEV?^\9VJߣmvG1F~>~ǝ"N>Ej&FB8OytR] B"|! -ޔVzyhtyaK;z&.lqlv8zk`qN[m? YzҮCm1">gя |/ވ\r9&Y2߷c_Yl1͞qm":;/?';^4+e})\{]éԈ'رV3mvL̦ }z]yf ޿&W"v[LjyD/0/|I.1q_AkM_cõk|ө2V1ѻ S#2?ZmWK;DϜJK~ 冞@ ff*:QEu٤G.dvwpu6ѥLvu' q&MeT}"N,Mzl҉ndUb6W'=09.\Br[ /Iz\(B#22.bMңBQj"%=*,.b҃B(((((((((( ."%vS%v"%v0S%~? jR%~A KR%~iLӤ"S{Hl7^` d 6#J7#b[4j[06AUfOͭ2um/tBхf]GĔ{eϞ= {ZGK`hl-}>ZG `hl(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((("%=(,.bMңBQj"LzT(ȸKP2?.\Br"6W'=.9.oJz`趪M '&=4tS }_6鱡 EePӡjYLJ.e;i辻SjOiCYΩ=YUvfS  IktiexNzx{(Z ;76=X#FO]ϯR߻ (pӣ_&3(.3.s<.Ɵ2qYP2q+jXږ2qkےEDD@DD@DD@DD@DD@DD@DD@DD@DD@DDn)7ۍy)7)7UQ*;+ӤNO;{Fzɝ}lҢQ*ɝR˝eNwڃ;β endstream endobj 34 0 obj 2569 endobj 36 0 obj <> stream x\Krׯ8+ߙ ݭ1/w w6/^YuN"**3#Enj6lon-ԧzS􅝆?ocЏcn? "AXvy)&iom=+N^4]O8, d(c6!Nʓ" h̜ {yx"D՜Kf"xɹe69^JX{uEz?TALQy&XDpO)EqS:U 2H=Q ''?~Lx, @D DG:O-hi\WTX D5CIfO+--8}tR@:*#O'''f´yavʣJO$3 L@2V:A eѕyIIȘ +z"9V;s;@4JD!"HDL{]{m46lU(V)[&dZ5F?1Mʸ̴zTI"Qƀ K2`Z3K(va*1 1Vl,] :[!ɠѰ6v',}v%'lJgePA4Od!6lXD5 3T¢DWkvѳf/ Vd6 '|%1$!*c&f <Yk Hp穢"wFHd"U8H'ϸQd2j *7h>K\\痮!'2PP(K̍FEur/RȤFH=):LPa\dtě$!1ja/ӌUZא1!y-!@.@еSsJ%.օa]|@% , N&sYҒD)nwN>U.)tIL7D}JKjwI_ a),c)F\Tڸk)$W>m\[ʴSg/|1x*q),]5K]^WoP>Чz)]AJ('$wKA8h7G1$PCc\-HO1 :xA \Pruv d'T/}A {]tr=K5\A.\*߲tb\Խq}K\.]%7]:QwzTK?xCzgKWMm.ϭv\!LdŘ<!]ߡ,Qj0d "tB`:& # M ;9]U"SНA bhO<|h5y:hjNR?.0nTA.\wl(QCGUwJVb"P,'W^n_[~]mOx!!.7׊SVz C9lN 8sX}Bwfcjx)P#kzAtwt"Gq^C9wGor=;cOP "N6.FTiUቋ-;٢7l4E J' iV[ O XSat7%H>A@Nlj Eͣs&]I=gUk}!0o;@qJCNUg$#x"AL=U2t:[Ji3!'G%_D U0'f{!?0x Ą>'2!i̟L#(WF=HD]@t=fJTwi) UA *C<$OS"tvIZm {KHZ%r/v8H9@eBl1~7rВƧ{#8%InLL: &DćCh,Τ}T}RPJ(G*ŮSŔ+Fswa7A͸L٥O$nlJT{] k'eF䁣Ӹ$#rt6OcFi8 OM69\2hͳf<"f/0%afm=GuaE]ArP ܁YqRw9o?!{?o$%P>prشbO\BW@n]<#''<ɖ{b#.mw8!)RXSB [㜡="kI:NT9Q3is9?'ʚ}1 f4g=-jMܳj#,Y:L/!u0E8Ogs-K9pW""WKi& q'E]&^. |,lTjV81zVnQr^C:G8`S$/vidxUktK CRQ#%8;bֈjTLgFGj%HIZ:Oq2AMluS1}'.TPÖ.>#܊c"jnT}TNń~LwLqb%~ 6ճ+{y|1Q+/Lꉛ_$UJmDY$OO+Mͫ%3˪oFTβnJeI$z1^3l6 sF-ƀSKrpD׌-u~h@V0Ӡ7s*l < :YV";=GmQ _Bwƌڡ/7!7yt({2}߾]ͦtGZBZ$M~SAU||y;ϙ"c7)$֑n/UXݙD+k'p!=ىXyS;+~"F)`s\`„-eP{dU? |c m 6|P]:Q}H) 9]Cdki5Ko'=i$t"YFBHs޸Xکj ;ssf8*WKYx* ՕcG'`y5 y/9NL9uj#,f}q锷E3N8䄔5ؚWCcsbloJ߽#L~qV'pGiB2֬X&gT} x3S٠\r%*YgJ~T:sT3K6+uO wƜT[FTdᢙXUxil*-]]3 pb2"B1{!撢0)6cț>Fy]I&gwbY}s5QKs6"ⷵEni{mc\Q(v vIp鮏^u_-zXEKpu=yMSNW9r89bh'.#BV7X݃ljx`jeܵ¬ـjD՝aMSbSYF!bpxE9.0-Y\j\-s8(ėc2aRX)ai1x@<붇Qg6(g\~.] m`dUY<.;̗OM%]T2#rF ga6Ŕ, g<+ahR!_]98<=''UgyMogϻƮ :髀S*(OgEk,ĕ&|87y$ǹ=yH/slA897Ee-n$]616GСut|^-OFނ˜v\}{'dEӇˀCnЏms/KZG:0n/$~[*k!-ۡǿAnc~Ret/W͇Bg1aUdʹ{ʗvI RE,lfhĴE4hz[EEڻKuVZ[m(.G%.?GkFڳquZ4ZK<2fXR1{in#ɛ7sڸ4ӯc%],OP0yh$l@R}m97뮂CkswBNY}:洘XKxG< YFCe6 w tjDz_w!wP.ڣd>ݙ*g]4e/$gu;zg* 1ۊ/L0@؂;F?PVw5}gJdW_#^o3G$*zuQEw~=_nO7'?[ endstream endobj 37 0 obj 5742 endobj 39 0 obj <> stream x\ˊ%IrWuC儿ݡHҮEVG#$7}۱Ǎٽ`hȊnno3S~WCoynwۯ^m>[)޾x;^{xoϷ~?[Oʓ͇6[)?ݾzzJg2|w8S$@# ؟M<1$4f$ciD8&9kK`Wc.9 &h1qcr;9fZ%ǘS"`>aiPRtlx} \5Рz4] Z Amǥ*ώBZ)WJ曑8>61cǓ8'OL` lL# E'7q{scO2D$J ztĴ'6q иA v I$əJKvbH;TI:\1,bT4%K{Heo4HJdtQH* *Sd&"@x ҅*Ļ`Ae#Ae/êqt5Ug8dٴaqqMwǐ~,=D! w!'ك]{6㇀A`Hhb`AH&?;xe+3C䤚yDih6rŴ'ћF]+ު\nO{_*7ggNAM{-`&nR"7%H57qYK\G&M>bm\tz97 @I+susV`RI[W݀nڈ7,Kr%~3A]v~A1f kqbOv0ɒvSId)0wփe.;%%~A]'7LUOr5xZ0yv Ѯ&v"*F-;I/\u~lܶITZ8αR^=PlV% (s%Jv0 2$@|l F~V;(S@eCπC@;Dd X༻S=u|Qc'MF\NxsfM !w$@ *E:R8aXXN5: %.15WtX& &*se)Ug کrn2wqN~(>?@.PS>'YHgu>Ovg T Q]L" W{xD 8pOe6xغS@6 i'F<2_U .U `rj~]R!MB ;`ܥ{>xN -SZ qp&h4ФFm$wl>4gd>@kC*Ije[ӄ.U ).I8O։XIJS߅֭ -([׽L54 ܨrJFsi^oݬ z׼Hu〴R7=UOɻvW)j^փ~ LE5l^cckIf+3u쒩J&U ޯMz:6AaE:[Y sΙZpܤR6耍ï̽ޤEq'{I3y q8I|@Q:Y75q7QE즸f5Ƀllש~6;lH.TwR֬YM N.9П?(uP4LUNgSkd&)&הIUU;m0Y)knv*6`8|LlY j7|!s-#د HIlqn@25!\ Ge9"z;D@P*oLst<1w;'r)ÇV- { O! %k4U8 h 熁¯ ;*' lQ$l|0R4;o]}\ɾd;浪Aջ(5CZ"#ꒇmA}V~֝r& ي2 Y6?ԧ> Ӓ=su]fhHj PUY²pӟ#7$ 7L=PzΗ6G'Ӵ*ՃnQeg硲 CI[Œ3-6|Xbe٧3,2hR-QoѱHht2a>Ϋ!)^OqKD}=GY-23 gt?mFoft/"5*:_O#8\xu~v̀U`kc'WG-37xIK@[s9NVʔ0{99Eef> *o9}:>!]-NܤM9wy(ŗ=R76J EK xx. Ff|QFL B ꔹ[um,xuPb+o$ϴ[wDJ$k&TZvJd{'Md;6=?&}#i2E`;Dz̦6GmFo_Ug«M?Q.j} v0duW8( \z'w %__\_*qY]JU-鈛kŸ8)_5̓^i œht%'iIqJpqvZ?^6}#du: >xz|ЯuD/OeBG\sW9,/.eeT^,:SJ"J-OZLs"k@FByS!vV!z/|`3zr#z!>kwT0/#S=L_oO,-gC] m`>?v807?r}?MM8 endstream endobj 40 0 obj 5634 endobj 41 0 obj <> stream JFIFC     C   " ʀE}XNXf&Fbiјtf&EԶbi똚tf&Fbiјtf&Fbiјtf&Fbiјtf&Fbiјtf&Fbiјtf&FbÏ+jo͔UИzq7&>ea!Q7գL?G"/Pŏ\iLL8 r/q`( oz}EofZϰx6*Jn6:|[h&ba]MŎ7qcS?Hj}K~^yz^yz^yz^yz^yz^yz^yz^渲km)g{PqcS?H#.uP>&wuU =g6%[ұ?St6ŏ\iLL8 茿|v^$(&B <$(B <$(B <$(B <$(B <$(B <$(B <$(B <$(B <$(B <$(B <$(B <$(h6{:-1b6F"mшtb&F"6c!5Jd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd& FBkѐd&2{Om>\/P>&fȀŏ\iLL8.śO uѴVWq{'o5n{LI:U_Z'8z'NU0]+o)xi|Rz9>__@}R~/%Bt `\XƔÏ꼅2xK+6T,5K+ RT,5K+ RT,5K+ RT,5K+ RT,5K+ RT,5K+ RT,5K+yFb-K+5T,5K+ RT,5K+ RT,5K+ RT,5K+ RT,5K+ RT,5K+ RT,5K+ RThO6 m>/^8nể8nể8nể8nể8nể8nể8nַ5KX]s=7}^' Dw 7ppw 7ppw 7ppw 7ppw 7ppw 7ppw 8%\iLL8>śO ]{ծtZV2[hLVr]g-a_'׭TKX]s}ۣ~o1厚\D­L]?Psr&WgٔM ~z6qcS?Kf^h/"ze>"T'IDK1>Jm\̺#.G^0s~z'rFyP?39}z(#6voI)xMt:kŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠŠšRQ=sr茿UUz^+AWh*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*h*hW4oJ124P5@3! 67`"01&QqjJt8ǕT'ɜuɉvtfTR=+S3TK(G\̯!)⢴3!>XKzyNveOݵ<*[w5o +Ssoom~No۹۷{ÿ;D3o>oU'OCo.ֺy{%^?7SSZv)_Y6^lge/RѾ0_]\-˯rļbLz&;ž cPQ,-m*HԨ^d i:t!R_"C2底:BMo^K|_~V E꺋4&_T ,m'Bz+.s.YQaZ9TqEЉon@ECU%{:WIDVRҶ8gY=>OWIHiSSjUզQmJقU>c.ljE҄z a$?g6KyNGc&)?i|Q >ia6qO}Uc*F,o9ޝVK-r.Z0$bPWlUQFklBv*g|Q >:JJn[ҴL)Qeokmlggmk%ˑ.Բ;t$+Yc驵oSTD귿g|Q ?*Z'<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,xX `<,֭ըrVqT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj B2J.)j BT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj BT5 P*CPj BT"_tiƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqYв1la58ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧ4FhӍqN4iƍ8ѧj}\So|֟o!~W')HR&m}u(%$+oR?{=;QO $Aȭ2;6gV'B!;~@Id&,Ё%=B)O;QOY*k,{a={a={a={a={a={a={a=ce{a={a={a={a={a={a={a=-Rb"!012@Q3ABPqa?~Cɐd<&CɐgDd<&Cɐd<&Cɐd<&Cɐd<&Cɐd<&Cɐd<&Cɕ\^%0[0@kj; J|7_t QH$I$u~noz1kOwNi;ui:qgN,ŝ8tΜYӋ:qgN,ŝ8tΜYӋ:qgN,ŝ8tΜYӋ:qgN,ŝ8tΜXz_/Z6R:=zZj-B<z,\%IlK.d~#"LKu1-ķSLKu1-ķSLKu1-ķSLKu1-ķSLKu1-ķSLKu1-ķSLKu1-ķSLKu1-ķSLKu1-ķSLKu1-ķSѨGbK),K),K),K),K),K),K),K),K),K),K),K),^^⡯[ZoW}^zxKHUD Az|j^%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J+jMGMVk;k;vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv6_7_W*S$z0/GjOOd˪dr9G#r9G#r9G#r9zu/G#r9G#r9G#r9G#8~vjOB!D"B!D"B!D"B!Zk{B!D"B!D"B!D"B!ҷWZ^[/Sk{>ZZ:~0[疟\:..=R\\\\]]ijx_I}%_I}%_I}%_I}%_I}%_I}%_I}&tk{}%_I}%_I}%_I}%_I}%_I}%_I}%_I}%U?/QR"b!012@3BAPqa?s:Dډõj'N;P)Dډõj'N;Q8vpDډõj'N;Q8vpDډõj'N;Q8vpD4*W7ۗZʔTV1E1FsRKzq!K<ә1C"I&S7A_Q~i7nyw4ޟ#r:#r:#r:#r:#r:#r:#r:#r:#r:#r:#r:#r:#r:#r:#r:#rO侧z"}- R.&?fW?o?}OeNS*/2 /a dJe ”R"HI"R)bR%ZN6WKq^-z[n+WKq^-z[n+WKq^-z[n+WKq^-z[n+WKq^-z[n+C ^Cԋ%ȋdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKdKd8R?"~Bl$I}m??"~hDP8_nciәK)e,RYK)e,RYK)e,RYK)e/,RYK)e,RYK)e,R4^Z0LƞKy,i䱧ƞKy,iZ0/4O{)e=짽S{O{)e=짽S{O{)e=짽S{O{)e=짽S{O{)e=짽S{O{)e=짽S{O{rh/M#xh/j|O"7T*jcmNC^kO4$)xKtJZ838383838383838383838383838382h~/&ɲl&ɲl&ɲl&ɲl&ɲl&ɲl&ɳI 6Md6Md6Md6Md6Md6Md6Md6iR_ߧRr*D1ܭr!|CEEB%^riͩzz%M4RP($SPS| PPP(Np\E%Ni'IQ4y ѻ@T.KpvMכO3#UI92FB7 m&QdPsj4iC~usМ 4k.\ K9YB*,m>? %ff3_m|Vt XA$SaE ju'I6E@}Դ~΁ Ac%CY͒z'l=ղd$SHowYN#n$=?ܑNGޖZx38HcG쌞mћQkt2/q [:ǝPc ³sQ*x[M Eڳ;AGbJ")y4-d0"n%?=a#H E>UFHDhvh! *aFyCΊFNd$_d2?`Н?VYB=l*$ 4S_qK0 Q)+ͣd5 4'PeWl- D4zU$0:2R53^NFڌ)To,e,Uc#eFClBkWO拠փISbU 1Ns5Gb#+o0AY[#"!¡/E@XDLZ z( elx,ՓʱQ}K}_@9>$rjQ|K(t*mt :0h4~}Z~g_ ?| BPT* BPT* BPT* BPT* BPT* BPT* BPT* BPT!;g:Lmbb6vXX]F.#kkmbb6vXX]F.#kkmbb6vXX]F.#kkmbb6vXX]F.#kkmbb6vXX]F.#kkmbb6vXX]F.#kkmbb6vXX]F.#kkmbb6vXX]F.#kkgtsC7htpYl6pVp8+8  ggឃ͉9ɦ~ggYl6pVp8+8  ggYl6pVp8+8  ggYl6pVp8+8  ggYl6pVp8+8  ggYl6pVp8+8  ggYl6pVp8+8  ggYl6pVp8+8  ggYl6pVp8+8  ggYl6pVp8+8  ggڝfDlW퟇oi_4RT?ܰ6M+ލ"bVM tȹA,1aabәGM$AXũqf(Yb )i6E* ZҭF?YXTjY(VC#5+o*Я77_s5MD&"ɕ A%ǖRV.:xZPJQ|d\ #VQIR2jލu0U6&]}/ a!fJSE dAˤDFIšYQ%OmB4 SHJ3 :CNq8$H(xeoKUi# 4fM.ԚJ_QofG n'TN'5@7bSҬޜ͝-/Z퟇oi_z-Sl#8O聊"<8)5GrCKa#Y5k;9tBV2*o، ɑёO͍$U9z1`KP*R-*cf;ΆQg!rsP͓hW>&2KHY?n6KMQ@&0m9%Ρ y4%FGHf-PNSIS$2ËKM^)SIj50=#aOfdf^A8ҒTC;д#i1 HAf'*f4t*64=9E /az'l=͓{JQ }Rf78mDYtc$5__2]6ҩ%IQ΋DJ"5zv-b VNʱ0 W)溇1ήr%hI4iQSG6H@\m I-Z7YUO+.aO :o; * hYm•MT_ RM79gI^pZӛ誊Yg!eAH:WsY4NjOYGZezCRb":qT-H$UHTt1n@FYVʚHC%?Ps1 s*i k7M ֪P6M+ v8,WTZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!ETZ!EJ3^&MpΠJw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)Jw)JwD/UU%M 2t%QPU ]VlQqBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWd'vBqWdYEa_#6],Pt!ɖ:LBġJvnPApmW iM4zJt/By5:[T(^zsUGHD4bTUHb) SpJ *CTC%Jl*W"2K'dWEB >&rRyIRf: $kOE9oA~F>+f)>! &̔i*N TbP4&Cϫ-7>_!k%Tg ̟PTԃmI sY:Y9ã0 DA>?_>i2 q1/kM'w,dۃuTg4~b1<SHy$ υ%)gD ?F!;gcaҼ}钿?K59KKQ'b*7)!%S҉4}-v^1 ')蠄++nI8,Pp-DUɐy9Ҋ|ϡ i8fhBA('QhK}4 д 4 i"}HNykz%1P%'IMͥTTQ2iit% yqM:LޚC´w5"T<ٖP=Z4@T;4«m)1bdH2©q_H!io6[:Ң\䧤%p!'DSA -pL$.oM>퟇J6퟇0;Fg觠j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`j`0I4(GȔÙQ'9 j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT~xgAN..1n%h j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bw;PNT'y j5Bn^F>qfY^$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$!)g9ă&pm &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &x &xca4jQ]x~>G~cp10i^>\A2RyII_GZ&tJDDnfF~m5#BhTGOOBv? }4zuRz?1f4y]ɮEf*O:FH^Td6tIOG?RyNf~;M_g3Z~F>+c"! LuHM2-k8eO֎?aJUI?[D$I ?0ɠDeVȚmS!Ldk{c(deF[5;SeAR/"}FzHVGɑ AќJhl#3j%_3P71g(%?ja;w>|=U %2 %ƈ[YA &m?)|2])Bk::ui",-rÍ#=$C42\QBt!nZuEj-dB٨J򁶸C7B-0ҙpQ.B! 3|T)IRPPeN2ʣ&sKHOBv]x}OU~d ZE 6jKtFRT61QTa$eA]1qY3*?D>XqHeʅSK * b  tthOtTT"b2ɱENfH1T'BL礃osUߤ~$iW2i_*)}_gF2 tthOԌR B詟r7܈iKI*LʊFO~{*=_FJsL-h\;tknVD2G_~tt%O(NsSNe߇T*BUUd^V퟇JmDY!EA!$_!E!I?tt h*~" (cI'!$Bv? }4zA~D:E"TE4?MOƁMOTCI'!J|HTT"D_`FiI{L4t}Z~F>+;ăM>퟇3ϠIs0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0Is0IsKh 6i9Ăt椊%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\%\tӝO-!1aqAQ@P` 0p?!pt}Ygϵk>}YU1l]23}Ygϵk>}Ygϵk>}Ygϵk>}Ygϵk>}Ygϵk>}Ygϵk>][үO̿~}Nj1*XLZbz:kF/ZzYQ:빴7ZEuzbwuLєg^F HMLꗐH)'R֣_GtUֿg1XRFkEx|f8l52hD:68WѺPJ|]ҥ~F׫ X)oTQ_ U04Qm^j/j"Q _1|*_ANP 7P4VZ$.kӉO~kWgG(YVT[:ģhT ~H1Nr^fJh5PX7L5(O@fƒtW:UvW.S*hT]S}6_⼷Debu̳q(VECJ`cT1/M*`;-DJ5{PEGOvOOi}ִ?ì5Xk a5Xk a5Xk a5Xk a5Xk a5Xk a5Xk a5Xkj~FZ=5kZֵkZֵkZֵkZֵkZֵkZֵkZֵkZd! GUaeT2fݻ)ҟҰ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0pyRU !FdU)A6DّWa &ٓFcT(A&Ƥd6LNɘ2k;݉Z#f%Bo+)pՂ3k2MҶEUQ(uXɈ~64Wzjz>Z0fތnm%̛6K0i2:fŨ^{Vejz Fs;"UMuERP̖&@֖c]h]cSQquP+ۨ]J_Q0胳)gUNB+/'z;񹍍R-^?C:B[]SMɞihT z/˪XțvǝFt鰢J.f)+XKA^fwiGe=4WѣO2%䨫kT+1;PWz" FYzc?8GWCuUEGA|Y*]$Hi])օEM3G[\qn=TR,(wCc Pt>hRF*D4ޏ<]O Q4]hb$!.WLA-WtvoJ#y<~)&uugC^< ac= %A1%8-_Ƚ]p30cMvkQ >EE:V'SA /F9UB6S0^xt(aNfMéC0ҍ:l] yHTmErE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rE"ܑnH$[-rEmzo]7:}٤-!i HZB-!i HZB-!i HZB-!i HZB-!i HZB-!i HZB-!i HZB-!i HZB-!i HZB-!i HZB-!`Nk9PTuNXDЀr@9tYb?$r@9 H$r@9 H$r@9 H$r@9 H$r@9 H$r@9 H$r@9 H$r@9 H$r@9 H$r@9 H$r@9 H$r@9 L7nWLy= Q"gȚDM>HiVc y=Ǚxn,,18V³G= Ġ'{R $_nte,VI窥7$ѺߧIb7ɖc_U!!Jт՚y=W`>KPN=i#W<ʺl*U(u&"*] ItMhvS2ϾHsPCT&!:$qR/fϾB yUMwܝV"Zc &{~_-?B-VY݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉nķb[-ؖKv%݉n”vՂV7 _Tzn7 pA n7 ~r/@=z@=z@=z@=z@=z@=z@=z@=z@=z@=z@=z@=zTGD4fs~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4~COi ?!4U->#Pdr1V< 7_ڧeV)IbtQFbUDSܥNPzё+4dβ-kf95E%X]ya;otDձ nmjwBȿNa.Qm`5T15ybU}4}!S:nшjMӒϪ1hyn+QiiJ5!~$3U2u6l%^lp׻]zhd<3J-keg;)3#]%PhG]OPM))y5+7NPmRuL}uř0j`K]TIQ.[%0eWRB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.H\!rB $.at}*lo;T5k$IY&Md5k$IY&Md5k$IY&Md5k$IY&Md5k$IY&Md5k$IY&Md5k$IY&MdhĠDnA0ډ)Bk$IY&Md5k$IY&Md5k$IY&Md5k$IY&Md5k$IY&Md5k$IY&Md5k$IY&Md5k$Im==Ϯ(èn?11c1c1c1c1c1c1WiUL#Hc1c1c1c1c1c1c1bʹ6hߨj `vMVﬓO&eģ[3Y7-jz/z}_odg椛dw֕K&:7N͖+V Fԫ|OjiR7\s>fZ_/x+<3S*SCMEҸyuW2^IJERZ cXw$wD~YUR:]?mFLxkSzS: gtXߨϵڤbnwDi`,3s%97:3n#qv6wzw|X*t1ϭ}*m 6kSQTI(4F8f 䃤[r]]ϠǕm`L*y:}R H7]]4 Q*Th^a7\h+N֞!s>HzJ] TnI:jxL<?b~ ;>'VTrtYq B`$02D3U[FOkG-( %cD: wd7s^v*wImDqOO$I}!AP,4C(ie RHDȦ%MBB/$I.b~ ;>=vBdUPUtTDc䥁hcCDco1b! -m!ib⪂qͪ*edE Qe~ ;?=_ }}sʿ}}}}}_}}h/}}}o+JU}}}}8OO}}}s?*a1Q!A0@qP?f=h{Cm^{C=h{C=h{C=h3iq~6HS0M^&C(Ǎq~&m#~M6H$9&}1#*_a,}Ȅdb;k|S*m&D΂S:auL$KHL21JBiI1./9ZRq'A]Nu$_\r.Eȹ"\r.Eȹ"\r.Eȹ"\r.Eȹ"\r.Eȹ"\r.Eȹ"0?rS%mJ+jVԭ[RZ>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[>[~0x$ic~0x3:!`ȴөF8`Y-%țX}o#Jˣ%eђYtd2V]+.FJˣ%eђYtd2V]+.FJˣ%eђYtd2V]+.FJˣ%eђ.щ蕗FJˣ%eђYtd2V]+.FJˣ%eђYtd2V]+.FJˣ%eђYtd2V]+.FJˣ%eђYtb&K"k}1cُf>}1cُf>}1cُf>}1cُf>}1cُf>}1cُJƋ4_+A‰M =Q#Z "s_$5/4_td-H< $" D ')||""+Ȋ""+Ȋ""+Ȋ""+Ȋ""+Ȋ""+Ȋ""+Ȇq6WEy^DWEy^DWEy^DWEy^DWEy^DWEy^DWEy^DW.G3O^e^e^e^e^e^e^e^e^e^e^e^e^e^c >՗yyyyyyyyyyyyyy)ƾ4^*@`j!&xAAU M/1pzuƥa'5 ZMR@A `ZC~Ƌbt nuPxK@ĊliIsNdoDgOOHZO>^dI%PI: hTГ ~mmmjpmmm!-!1AQaqP`@ 0p?# 5[bŋ,Xbŋy6CKV/ŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbƥ@I OuT6S%;_R |{{YurRUKT] R Nr؟GIb.6 %],4,hgm`A{4%U hVBw M*Y()IvWxZ w 7q&yB\7wEM]MˌZwK~MH=cs$K b-b0֡v1`E M N*TUwաT0F_ғcB_nUnC`j@YS+WXY!(@Awl ']ujgt" (J\Tɀ5U ׄzژ|ARPc6|$j&SCo䈒EaqP uFM(:nQ$p ko_Ftmއn4tٗV sP#L¢A[2ыРZ٫Ycz"D569B[|GEěfIM 41bhoCIs4r`tViKƱBKqY n:05BEΫai?H@ILLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLKXO\w$ kZֵkZֵkZֵkZֵkZֵkZֵkZֵkZ֪Pԯ("PN5j]u] g#w*뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮺뮎6k OOQ*%-{\ޏqJL9H!buR'ܾ9?!PAlEH&$:-oR'BQ`s2#EVJ 褽[ZB\ܨ庭a^dB]R:\b֊j0PXel/¤A/q3f.A ѩPsZ| -, r & +JAZ ~q-Uu֦ɥ }ݚ5 hO;k$h~G Z4[M]G4^^(< n'&^_qp 7;LJd]Z];BV-RK_ q MZI=-pPu(i`,V#T ~Rvydm Ov  m Ju}JkxiO+lnM)?cv v| 'Z_54q$!/nK@@?!b% L.z뉫]@;tm˫04UU4NWjil%Ae N-eQ'җB󁍠 iugZe%WWhƒz*DنFkz .o$u}`x&IRİj s.4\ikEk(q:^kaH|-b5ЩCGhf樐t;$[@.(ʶk8D`oҸJ6ڸ&T[.Vኳŏ̈#oaCOA4T42%4V)t8A+\cfHg¸b;z'Sp,i`eRRiJno@ soEP(-:n j$( ~e'1oL&,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,nhCٔڡm%B4p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'p 'iaE]?ŴX ]h< 8).k7~48pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ$sj"u-䥼05t?EYKP6%Rޮ,eva'l9հT&릪SZX%j=jn4*`MjjCql6,x';&F .N9mh?Z@~npCQ~OK{P^V/םxMK%@6 k2i(O-BL6 bJ…ę'RimIwhzK*ubRM3L <[/%H_SFm /Dx8::Lpir݇ψIhoқs!Hw(Z$@XIijnUD[}] .֛JmMm ӁV"k j4c;6햠YK U~`⠭Rrt5)G>לֺmJ5~ZlZ҂oCt;@]ۏ6@H Ve+_BVR~mK?F񶶄F+%Jh;u-qs4o 9¿Y qsJom4kTQl5] z T˜,-`ERV8J*U&ҷ7;XB_r@(,w=kBt/l+bU$tZrICr sj(W>AmԠbnD_D^[jz~#'`6}@D)vMՖ E y>?%7&!he%YiMtIzt{Dh+]Sf ,5k^ah49JZF|E45 -EA¤Z-X82MoV\׳71teQni8hڠ#bj̤E*Jl稟]P`?p@W\j l;([Y%* ׆~e_[F \#$5e; ({], Y[MzzBIWόB2P5n چJ?Jom*-#3޺ERTRNUMb?h"URiT[ZҮr`݄ Eղ߁򸥷rS9[o@dG(9o/YgciMHڍ`(WpEKb)b:EmKZE_'$"Tg扵 }?4JAۻJS{n rISL׽7 7&oM 7&oM 7&oM 7&oM 7&oM 7&oM 7&oK_j\6+oӀi_})m&oM 7&oM 7&oM 7&oM 7&oM 7&oM 7&oM 7&lXuT endstream endobj 42 0 obj <> stream xu@tH#(6؂g'|X@[QBvbG}3{w7?`svvn?;߄zu٫W7سZzyk`uϞ&1߄0S `W`_p4@_9x9 ]``ӵۿ=#LN ^8:;|'d/1Ʒ S\wzN`^x{tht+OT≓O3ѫ3^qscŷtMcz\ ͒wLJ({%tq5 :GT=@SO.xxa#`I(>G~yb|lb5I 9ց A %G`13S3Kt~A@{P#Pfp PO$ػ$ݳUĨcLe׉Vu.9{8 ~$Ul U'ҍͯէj0NaN L L3:qIz,Tӳn^E a'WE`/6WՍ4fD}fUufljGl۬@uRQP̰XMׇxnPf '7ѵz@H6oO4QcDYS*xJ<2JZ8ɩ59EGT`[R֫ЎeOX(.ܮzC np0.J8kp`#px4{_H:9:YtJN^`-]fp"s)@! .1Pdb"rPL>1`{,o:|21e-Y@SASd]"֮`d 5xYtLH+68g!A7x.Pb ZtL&0+p9hh>-5hSuSK0udal`/]PgUҲjH{u}5t;\[=R*շGq}.PbCn3[H'6m(q5ϩ2Е, Z&tgj5IC>gYȥ6W] q >Ngܐh.Ma̹|^ >Ӊ--ѕ`8/V׼LxT"` >v[teL-F'e L${<+nʢ?* "? VV%. |@',|ڕpY :t 1JveiW ~7ʿ.+̩ν5̠-/gtk^ FV~Ĭ?AY& z0ъo$DCS iAeub`Ox s o5x) ݨ'>"s'1X4Mcw&Qg0޵&kݜ44mzcx6 kpeM|r&EP2=k0ި  PPEd4@f G 78{ܲg@<'9)b02Z,)n"s9e 0.L=ô&'9uXV4 GR>oTִKj;20&V0F/,,t2;݅v(`47/a08 =*pI=cz=ƅsc:Z[_OkkW5΄X1VmKÙVV;3'x'e]\fgZ[/B Ayк!E.y@u4܋MgfD_}Y?JC޸Fj&f{9(Sob-$v\ Ə| `0 `0 `0||6#`0~GJ3# /epw`=/=+gj0`0~MQ+ FnGG/$vcG7tsG `]/E7 GGLx㌌Ի KHP+Y׹OsttM=2vO")_^8s'ǣ.agU0ϑb۞.}/d"]J4+؅x@ȨdNexCA & PO_:w*Y[uY^%iCft%OJsI돹wYj}-8zI+2]SDKn[$5mTaci,tD0i)Qr\Jçn 0$;_({:4$ ^ Z@I08x@kQVS@Ӊ=rbo- 1?sTFO7ڏ>kv-?q3mAGUSOĤZSGׄZ}J4ul]hԄ~SS:3x+)mRdno*sƗ JJ|R"Wgml"lӖҥC`Et}( a81xg%.OiM@o +&DŽ40.L@A+>x2%ņМV>3zwzT=F\ nh>,su }[ zquiԤOb.oY8c1xYBڤc̽`H: krV2H ; O|H+d0J1=}:/lBHkls N'V,2xЫ\C ` 5XΎ^dΜ#kI-)V`A}B/jp'.0yՙOl-o  @ШE#20Zk̮^5)TԔ KD."5TXXT}k0kfe>O)E+2Y87"C "LHf Z(ƀTt5G PBR ȵEu7O+Äx"fo%W \"p|7&`XŒU ]-^ 3XO̡_ f$Urh+4e|m*wq`Ujp;@>}qjA$'OTO/uN^ n֯ǀa0 ն:5d," ^nMPBL[S^Š I*TPJM CQf?:d0i]lv#Bm>YGV/0vv8'KK'K~~t2n `9מּGb5?6KჿG7Qĝ/e0)ʻan0PDV4GDk),SDg:Xff/ >|0~^BUN0i 큌1yJtSwNN;1c3D'\Yn$#0!މ|}6/.^id(bE@a{E ;GqPѢ96XX`ge3U˾}c8 Gb0B+r>qAZJ1|Mc[pX (`AEE< )!A9°tiH` -0c``]``: %K͌ `$Ln2400Âb%t2 3L /ٜl:ݻ$f၁%MaE^FVkoCBkqglU-x &TEh6Y9/G;Z~7wnyV9õ*r3Tt<#)Hx#L1MMٟ -68*}e7yjcxщiq>qùJm9Ş&.@*jJ@.bKitmJ5[SIl{SЁk*@|;$_-0HY<%0و38XrSԱ,ZtSY_DaM55Wd4}Mr zcޒ,v%h!`pNWK ٌlݮd@T~T}kuI2L!܍X2(XUѴ 1`l̾I$ح$u-p'1&az@̒:0ѡp"%}3`L$ A+O. ~Vo}*%~7 S|} %s5VE{8[ ?t;|"j񤓏m76>=^#0fD>ړ~:ϕ$= k/VS#E1qU Z=>[3j)MNIJ|#xP{1>vj>io:Xpbd.zUc@16glXM.q ==:Бo}>cV [F0}4c m@{9f<Jg"8x}ʃ'*ܳ]p̝CBK%3YW}[/ݍQc -;٥*; Fjp3[rL^ HLK d 7(5ǁ0' W98 I >BUk+w^t8(RǨo*ppaF\ᨎi5ΤɽԹh[i`]$n\>ʶUBIc6\S(jpDS% r5*%jvޏť13µE-۱U!d[|[.(65x]^-Kޟ'jUw'Ep?sūWb0 \:W=sW:OrS& ? N] J,nu H_jmbQhѠ{d1Xw s 1x0`QdK.;YQ-%ypBo14WIUL3Oׂ<KKž\)zHRt5h?M)s5*VS@]U-E1^uR4z^z-ntggoe{߸HKRt *F &h-Zz\vn 5C[1 oBzFE '. 4 ٛyS$OghD2ԡ%z>$Ok~*KiRs~'AE~҆XFVaŸ@IrmFK.hI&Av#eVr*:_{tpmOZRe0QpG_%oy&71;1n=:,oq=:+NUڣ zq۷ЫIðGO0 t'mm/lFye2JI{t4h7Z]^Xa/qr_*{4Rб=]s2U!\O& @{U w? 'š6jš^Gx(w+WeHc`ʍ*quXK/O J=Vp]&krr1l曀92) >Āw 3s$ HHPiw\저 n %Dw!#rgeqAH{0%Tr*\ߔĠlLx! {!H25;]'fnAp)#RTZ >]! $~X@3u$6> ,`0䄒egw#n(y۷WSU噅td0?@,1][H{3JcD#Ocf_6`3(`2I@1_&+/,H0}'ZZڑ`0~QvvvICHVMxp K#:y$vq $+Sb9qQ%JZw? b0݈~5 (䥠^sZ4Z; Էʼnfl3JF~q̰669 \QB! >2\ٵ# ѡCaȊ ~;8:^' j^J𯄂t``־oߑYe2:}.0 ^cԾ}Ê.?Lme־tn!Dý+@磒a߾c?"~+Щ[ .,FGh^l  ~A292XBQ3"}(`ּwuݙx &lwD29\}46ܻ~1[]]Bz踫?~WZN%\^o?}g5W4ŗGw>^7|z<7wuW[Tsݗoasc+MNPqQϸxegV?ʼnH };y\]䤫;su[끫 z=ʉ߸NALa]oHu ;]]?Gu+Wwruݕ&38ɏG]yQ)(iN(pmoPgC:‰etǃ9r!oHf&D!gEh4; Ղf;<ПVLL9>1>3x[ _璃 {sǮ iWNgɘ6H N?>T+ i"Bt0gĉH q߾<11ҡ]I*oVLL;1ـ`zZ%9fCC!'ǒ$jWE3@'Mp7\%wA۩9/_5ft9xuK;Kexۚ\ *vuq=d;)FMźv +k0\Y*9%W-:ێ UZm a*1ضos[+e'eMs GgR@Ǯ_MDkڰD^HgI;q:<\)68s_eFv-1,4;­z7fq"-7jT_j@pɽF=O sT3[;+%Gs7  mi4&?jߒ08U&R]Tߖ')věG `!58q~3;r:KHhvvk(ezh)RփG.Jp\00F`F}}QK "`tC;I5fdGn}(z+0\x>'n!5X\|ڐGwVsFu͓%DB爳1ܿI6~8L]MDe1XF'I N~0Ar"_[(JV`.D{=Bz'k<;֠gTy֢S {S$;*3X`{=.#I ]ֆ"̘ I<>}q١%Bfp{Z' Søbc#@KWc*)s!蹊asÀ77T}KvzrZ4,b]׆Plh>S'J$5 |Rjp#Xhn34٬4ZA o-6 C%CD l:qIF0/rF+Pac@Փ 4K N'cb@u9қ~%+#od?ç#)F*#1>@*VøK)r@b8o446 EC`iG}P[4< ;J$5 |'58"ȩ(!+[U5TՏPd$li".TUcn 1x1^M@óoyBemK<WtPH[0$j1QjN;ӒQ2 Hʍ,5x;9oMB :A)`#Gv| jm={@`.OGL. c%())ev r2ru}($8M䙎t 734X飶yu9PtP+ƃ,=Mbd+WhCL΅.fdeÍ>Y=^A- %W eBsjkr-O#q-1ST,0 Ag6' *yBßVtn"6ESnRF-;sUi_ :3mIV q-g;֬=) 9Vx@5@nWD׻Ul.in@ ܔ=IBu'*a4.}5vG:sٞ z?-d|{R4/Iчoٽ7=z翐sב_Vkʔ>;B$+O/KH^%k"i"̙%W-Bk@SRIF^$os03G:a [qn"ƻz.Lc).:}Q6_2-+W'+K>7'eҠ)s| {ܑf?OƟH~58[pw܅h&{QbI(σE`|^Qvsi4W55^y}@N o􃪗Y*/!l\\(fQ918aWNpF|iG![(*E?/kTN .j/<f*//[= fEǖ<ȏ 0 y`3`Ca3 3@arbү~`3lҎ f00HCë#s0 P,H`%CXj$q\=` 48[CH2658bh s5HJ!saA<>6[ΟǡGAbL ~?*UV w f0m` z!c"7:~kh˃&j 6D&7 X VgoRV!٫. +3@Y{Aۢfܛ N5*5"bp5kk,^+Va85 R /5j58皯C&B5*Z lZuf0QS@(?{@va&r3xǽ*P8],z?0&h)Fh C!]YE{eȁ0`='o f0 }?鬇G 8Oks$V%rb1 v4t*'K܋ 矧 ay&GvIBL}3_e|cC0 f0!QoQ|0_48id׊06?3`2?A۷ѥ1` &y;x"0 g7~l_Da35n'.? 3Xg~lfpP S.^ܤwф_l 5 C|Rş{p#^ރ}TbC-GG$﹎$Juqv>\oPqIұ1#6' gx=n.郎SsK#68cϥtBa1{c,8|tE:@<80ps%JQ,ϔȑܠ#s&V]oF0y׷scJ^n`Fr*Yk#teɮɴFtK[+<C,n}d1krgX.fT&R*1vkm'g#p'o5[UUw6ghKO %4z@GmVGuWWJ8qJ@rw}=ۜqq] WKԭ..8^xDx'n$YuR24xf~DJ]}GMT&y&C?vr[9uM#؍\>( iϢ|nd?g%}"inoGq)_~&*6$RmTLu+M{ &ƪ&Jb?N_ {[t/fZ#Sd;ư,= '8 `( m+s2_„ H>$}Iz(n裧$~7 jD^Ujm^2`gf!n+'1z}doZ ,?@ =Ojp۳/|QZJz7~:ﻻ?FL;X|T`f\pwF vw+7$_x˽&=!v@mwLAH^kѤ\ @ LIFRskCI/IG"ĴЃˍ?x@J`2:69@ =*-|<|Fڶ \ \-hfRI Ƌ װ\?K#]4]CThB𻾓[0X迳 ٘*/9ymƘ0h*0^9#,ˤ&'Z)̜℉)TVFB/#PN-⧎PN:k20m1[ֵA_RIuS0Ss $#~"bתSCnUNA~ CDT+lX:uj@=]։*U}W8\)3cbFb#&tYZ  ` &1O__߸Jr ~__ nhi-7:\s)5,݈JJ\ 0ܬO ^f-jna@c %kyBA?\˔M쯿[lp3 G)–LA:C$ef\i0=i#HO CMF\jAt?Gb0mܢS"ȭ>*1%hnɋ0QLL}t_]MZ+ Uo@dx yEPTX\ H`:L{#?{!360~Aګ%}$yePy7t:78uBy0^v\?2n/3iOY͛^!18e2hW[udΪLlE=?sBQ!02"ADBv8a3V4Ӗ*N!n]]hh<{-d&t<p~-9x,$374TI&]?VYj7I θ[;U9o .+Ɍo&.8n͕ʗ~7@ݖ~i36ksIq(ܬulE߷1o( ɿ}#jN78Eb0-L~_YM״z4'] ^q,*\WڠPܬu6h4Z%m dY)J/0؃.|gCnWiceRL`WUPi@b0gUtȏ܁1TceJ`Yvg$8ˇD7=qk Ln@:! dHǪDLzţ)[vW&̓ncEZ6zf͂OBM0]i+IjM#& hn1݋')|0EGŠ& '?!w"gHq8sMXփ5+ L]tDMc[ \_#{g*.<4>S9jjѲ\ɞw3ϊ?e`CV`a} 9~+hd#NE{=!KڍY |x[qd>? _`.^-5x{nL 1x\qFϳZEU~*n7hRTv]bpK΢e @y>\$$Np~A_rVYrV@0v/C~( ^`93@eyrY,qTq'[SQ/|rGw}vs&]-r!7$H ,ԡ58"x_6x9ώ;f} -IB|,6!(NM-IřEc'\99sZ{%a*ҥOFHwur˒89prZxZmy gZPl>)~V<4P 9utLn❸Ab[z4 z7Rt<9 <1U/ɆjJY2 ʝCz4)봤~s+R%bp7M?Z%`pfϩ9>Nbpv?i_7J]Pz[Jc?NXrj=\3^..K<n0&&*뚂!gLr&ŋQ(iɺS* w=p`D#/L e`H#%~)y|\`bf,v`md3ag4ԦXף.m l ڻm͗ ޤ6\jkOs"(Ll4P랴nPG\]7=l~Zcyڹun{Sh㋁d|5CB~'k@KCE.Jޖ,ƒ߮}O ;$VSԥƢz39P ' P YN0VMMhqͺin\ v )X:案]Nq`="sƗVڮ ؎0xô,kŤS#d ms()ƓnEΩA`x - 0md$u0pzcYYrOV#N]$)Qx.q5\p,XC_0E?i _mRIuV jc% 3fL.66\IpF. eӧQZ5j6݃{TQ6h3|=ε!66\US07ՊTJ"0N+"fWztn8оr ^@@Lec l|u̾lcÏi66F(Ǝ66HzZTܮIzGNX?yɚݸHs$347'>Wsp%@3XE9YY2#>[ A-V-GC" :R_q?@w!|vZ1pʖ-wEbQSϩliwYQKpnRzll,2)ABld6968K] 5;%66:=7tt%}_x8@ԈsOdY0A%z9{13 9e768e2VRO*$lAJF*{s{y7틞wh[zfp$B: 4 d %.L{dbH8I+OqܔQl0(񯮜;w+k5Ν?bwgf0!0\ؾV߾:ܾ=ۛ=`3\ `ֿqoB+h`/h+V|anZ"L]̾f05*{%3(I #x[?˶2o#K{NfLTT2Z5乪4*F) dAvtTvO]hrh H:GIIY 1]Aori9 TTHWe[T+Q|ZdeVb+33U-k-&ZNSP5?̖"ifv/hakۘt9B<pT48#ؤAqc|D |]6Xo@u[m _׉YTN`l/7'}OMFِ@8cK^{6@& [79U@)SBC: m?P?kG:ݤÐx3G)ߔ)YGo%/Yu<yYߜK* rk~j`q_ PLtxZݶ_87J'1TR竄맭!Q]k_N@}䅋:0iΫ|`_"7zR]0,-$EP&$eczeX+:Ѝd΢_u:xPaa(K ktP`r Vԅc(e`7 s.5!G tDJJc⡚:8L>z)qYt~ں<>vq-~G)"ȕv@J˻ݹ&G_c<Bqb!_~bL_>`JtTpٻ+LC|m0r|#GjO,I!*Y''yfW|0; kAar)8.|.gZdZݨg8QR?7>MOx ©`νHF CޓB!Gtt"T.y ?9fWwyk .*? |<.ij=t 4JWBx+  E1a|KՖ!/n0yDn3A%G;2ݢ{{ ڭ/ J.c-~s'22w~#vٙ* &%h4AF~Gӊ^j,ʳGδ\|^1|@|X, r؉~\R4ʋȋ #vSiWWX7| -jV3K6$^x'5EJW_eJs)*9"V6v+4XȇFsvF#Qk95Xq%U=.6Xă1%l?`K)d=FO_gql&SronW Y9`1x3IEYO=U0.9Rw#! ֞u!|G6~:  0XXk X֐#'I8t]& ^bR2ƒQKAA7ǂEƘbOrPx6aofSAA1zט ԁz3 Nxr4^= 0ؿys?7+SZޠ0ەFC6?W冮(5V-0kE^ySy(ɢUNUW\s >,:׊h#fTOz,<%JFh~#kd×|فr<" D6 *'5q-%<'AWίMۿeb]j=FcҘ,[C0Vs!4Ӣq(,'7fjKSa~~Qۖ\?yIv?`~ߊwS,7G||iߌC˯}9qs拁3G(SL9lJ 6Yn0t &-" ]%|/oeD`f$TxoeD`E|KLj:  @&3t  ;?`0?`0? rY,W.EӦ,`a|½◗*S}h qL.0X1j :7vn``0>o'"/:"ύ!rJ˩wY`a| }#Me<ȾqE:˗u*[ښ 92*b7x/::rhue]8S ɾsS|'*˻>ڄ6~Fϰ^4N7Xrm*-C K?`Yw/~L#Dԝ "oO"G"Yߥi:j#-w$2.]r1np9mbmS⺼X0z,cmb" 6hQ@S2([g`P 5K/ءQ '"0abQVs+dbAw ]mi5i46DJcpX_r,6l jD+ءTcOYL[kj7ddIHm/۴pr=?`:Z+6c~ t  X~i[&op]W"$a,1 ^nHd٤`nqK +9'V4 ffMİ}9Y޾Q˅ >`iVd0 8m?_sqJiӾXx`ӁC1`Iԕd0ium.{ņ~ ^u 5_'q{v=I<*TIִ͘_{r}zpR1R@ O\.~)O|&F~(|#I'y}D݅>dlt%Ε/侕38b|ɒĩ+ޑȖ'W*KOcT%|ʇ=F|rZb NmE#k1x/O9Ѕ*e,5\vj@6RnR@ETt7)׆jF=ڈS+N))4ښ\zXDWzSS*w $c&Jy&'cs%*`0R͓r\҂ZmUObaVC"?:ՁұPI`[7Kp}*c[P?cO͈5J/ƽ}zDg 6{_gRDVN'>f)`تSH|鰏vB5NflQHDd#b_Т? Ԭ`0R۸.RZJ!z^ZǵQ¬_u7׌)o)ʲ/~}\tSp6wuYK ^Z۾TbTe'WWw":3w[;Jnv9Qjm_#b*^&y9+",존.><"o\'iFT-{a&,/T} Rpڑ]oh{zev c[û?Noj8Uixl1악8 6iTc7Q\ɏ/t-t\JK6Qp> o2[K)yhIoHԹ+` 5F<0e _VlgK˷dDc>[0Jqfc]K>K~9՗}vKK0Xy|>npDzE`U`B31hz)DeVv-:p^Dcwց~?GqЕ8q8#&H'@oӲid[sץ3uk;Sf}0dOFH}yOv`࿑ fmnM ;Z}j?Bowx/nMXu֚0T^OiO1%QY?F 0t%68ZJDZjն{Zo7ᆬ'v{3c`nSD ?!fJFm0;Rŋ M,ߩՐkG+X0JONZQ3:wҝz,``6B28'7/dVں.Ή+Kq0^E4%A|RV?r >%IQCiQ,10tq\ WDOfWmGL&|J`X5VkXu^cK@~JQtv ُzGÆU,f%26:1mw08r8]D?S*Z&|ʛ e?#~T.No>M\v.N.L"畲WN[w@H?nANkn>?˺1 Q)FuN[Vh3 0 0 0 0 S n4\'\`=8Ju#\߽# nGgdѨBeB(mV[|е&v./},#eL#"KK ٧BYkV2 fۨXv~"i.P"N GO(z R$.Wt dQ/5 }hBuɅ6uHko x."3g*s%DUGy^z>Ҷe&I^DߊıJůؿRsZZg젥aKU?鼟< 0|`)Hiھ)o;Qb B0A5ߩYb-*xn\Wv99*eEU^-=bYk,*UfOofCTcv [TNCm9jm߹>p%l^!$kW{GY`N68qAUK`m!}y7Pl۩{Fw}K9:; ۧcy[۪2Yk"kǦ>Uٲm/Vvr 16ߑ̛)SũeHcsK]D.2m؄]/R- g\~OH~;nm/<|ڄ`rk1ue߫E4/!&p/ndODlKBR'Mxb>$(GS#fδWJ-t6xyf:"ݏ{ F$24kS, 7n2KٖY{@SP--Q?&ܸq/z2c[\iƵcͨk;Z/UDn& :U;J)٣KV'!{[>2 7B>-ߓ'44M}u + ?AmO䭰3tF@[FP}5Ujnp?Mt|Djf;6XvNT,#rR[%f.+yP}+wwHښ먑WvM+K꣺BBR2FSYw[)nS:UO\MDؙ7mܕ䭰7tF7R&8E$`8lA^"`|[~]A"t|y ?XlѳbmmhXRbעs ~Mkp]ZhV;TɠqKIt Nc͞n^܏wp ` ?RK\lKͤrD7_̝}ޓg5רx{D㦗" ے5rDhP==\Gʧґ*.ź/A]a&dIy ga=Ytۘ6j=f\i:kVaj1uu $^w.Z3ZVPj;haFQ V" T=ZIa͡Q/;E,=hX9˼pPKDE'VH|97p44Ni5Hf|k+3<Α@~$Jt-z oidCْ ap־6ڋϖms zO},ŷؿD rVgNai"st* Hį=ъd|? &,7ٌĵ=zbD6iKP!787O=Qdt >݂}8i=oj} =;LhT_.¾y/68>'|qivwҦ닛՛3swqj{DW_)+/bm:c߬a~]4f\Av>ҭ0 6%/>@4Sgf_~dp,~~)F/$xxLb!U=<:cXp;G2rvIg~gGygnҶ~2#u{kNa01Xut73 gP5Ojj=fR" vuRjK^` oI VLmvB0( RJٕpg$~*UXSa d ܁컏~fD\1h^) P4P9DǎF?0e4%CDVz^6dxf\zۥ^%~ML֩0 c*g.%qn+sztO)z"7We&kQ;r.Zs}n3Ԏ`YZ-]a, .[CIap",v_ʹ,ӭ0 c*_OЮ 4,Z6ͮnY8&ze :wRmzJk7wĿ.-&ap}iѾF־,EP ` ?b6{ML68dyYR ,+[SjUk{i N\w~lTZM1fl'pZ. n* N-ochvna0S1xG+ FG;N.ws cojݙ44/+;;8z~|:,՞0xQ"˛] 玔!^;ҽ AI`*$\:?dߕcحy ^Q^0eY2ыJ| @m$np lYŢ=r Vߦ˪O c*D:rlnp2hAs9摪! x`NZbHn9O3p]9TfJU1B y͵Yˉ޾Ώ-{4>EshxW}Whz/v.2B|r` lM\5>u, f[_Y T fCɶྯ&M i[=me;S13YHS*{HMs~.M PN'|mTf~JcR>CUnss |/_ J1;>?c]9k^5SSztax`'F7ɤJ1Y Y^JHf>Z3&KJ |r jKwY?r<8 c:=~ K_?=uw pg9M?('U|@~L`#b.}"m % :ҋ\`ٙ@d_'W` ?0Xv֩; NZLLr`0?`0?`0?`0?`0?`0?`0?`0?`0?`0?`0?`0?`0?`0?`0?`0N+j >  0X?\L`nU5]`ľz.nL^QB xж(M?/*_*5q+Ѧ4<2tբ4RrIfxMYyPloSriET׃o̻SmqQǽs/-ʺF, R=^f2Yepg2̝dt ޕH*%z]dQoH9Y^L6/2k4<*l18 .o*:깆I628 gv#sjr˯"[aؗޚ}hpQ,$ "|yZtĞTnrsOS,5TQl0xJ ]yDS5^N7ՓAj7N(mhp܎fTa;_~;X44L']0xr@@鵰bT 38rܹ@v\L.ϕ2ScP L3 T=/@OA_s2W3hWLY;:\]]kmTHFI1lhk/^UXXX#Y{=b ^6C<"xy"B`W=j7g`m!:gY|tip918O~^l(MΨ9b6ΕD`k_y{pxU$_32AC-NVr9#%K`dE?מ'6^tR7*"0ċ. 0-0``B  F .0-0``Sy>$^=pnz:hሤb;T08.V,9)%N~ ΕD @ NM]HURR#fUrĦ99(+ɞQ>c5Y;9 OP?lhIap`cpT)BCK4N q:; =?Æ:^* DįDYdP,%Lv{dI 8zՒ[6oz7^5wnZ:P#rٔ 8g'3kǎ>v:[ ;L0aLk U|(ֵ軓j6xFޤ{Kv xmFhj=-מjpN[J"i. *nJd[&@t s v `008!(')r6Yf fdBH$, ^#FO(-HSۉܯOt̉ ^)G!D>BJ` S=,͛0>>UN0bޖWYɁJNgb/"=+18g?*Pd~b)Ԥ8\o|U|5Mk}!O9`u-:fݴT݄w B~]WHsϑE<`y7)+<}/w5{jCJۼrUd?\, (;Nr@Ga0UY`00Z`p!h \`00Z`p!h)!~4{РD˟I ]"az?R\`0%eb2rkV{[b"jw]hBiˈj&HS?9Fh߲,alvAF W=G1 U_RN,hL~lQ`ip졀S7N ϖ 4x34WM,bE>W0b`"]KҗҪ (-݉ڟW?mKvA 8?jS\wup`ߐPMjDDDΰNמ+ @q Dmv_V]b Q1=6 #jlaQўʏgʷ^4'9)40-ٞK|Kp2[\VmKn Ju&w:yO-Cu=o) Nh?JnY>cnG?d'U)]73bGYD =o)暳%F1&Oo-~;oϜw"usE[ c4=j).\-orQZY[UE|]XiBQMSW7bWZy ,-yCgw1w>Su%{'c/wQZrQ:֬Av:uͻmֵ'6SgD`f:> L\^UGw1- 3u hvDW1YA _3t}@ QUr?]{>i5& mO0̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`30̀& 63` lb`305䠙= ]P´\UrD྆(a^G*@1xi9C(0q endstream endobj 43 0 obj 34390 endobj 45 0 obj <> stream x]K$vǯ@Co *wc0w{=iÝC-)"3kxed=~J?O~K_-/KvLVKA?RQH~+Ǵp/  Kp x-7xLؿ=Xa) *c]_Jl0 Aۃ}D,Hطv5\~WZ싉%`acѹ!ɾǃ8*ȥ >8d?O8`q,#. |R_mA@ǚ11q+-x@> Gw$$D110}ND"N-᐀1>FT5QlŃ:M)pxMR)A;/Ak. 2cY'I6ARi4[Zife)B OlV.V (k.*Ko%7}%h4PXQ,ͭ@ =Ip#x$$%)t,a+k(Q$ <>:Hm a;<yTdc: lܐin@zL2snćTppNJmHHDD"!Wp \V2dˀ.gz ֕1#e F">F"<<W"I:E9{Šd,v0d\=z1 YLDhA%>$$BQR>ގqRI)W$%"n$CD9-ĉy z\DT"+"bMFp@hWtps $sWQېpJp$"U$tG߈&|9D`M` @g]0tr3Lb^w>!U1cz4Su-]%7-н/1tLlIm™عzzcaEfŚ@y.PAXj] #Dr r+(10,WذBöKe P9` D^:&YNUhX8)= ʅnq j2x=U;Y%T 11 uM&TTzmET~'<` :qʈ`L) `+\38mApg=r^U_N8x@ȂTT5[ ڗ>!zKW!p`DHb^A#7AncK@7 a!Ѱ:葺LUE 1NZrPci-H&tx3jG]B 6Te %%"⦅%"cHdK;*Q1a#QxX` a@SVX0e}u5eVE!Zd#QĺIP|S=j0`a?ąc^?Q jwQBoXQT##@%AtΚoS+uMf)  ;0`uL 71F5l0+!X7e1". VI"%/k*HD)]"Fpv&%;X>ȟ6~7K`(%AM1x ˊ9=Nq5ԠQ)pˑ)95jZlٸ "D t~l+ &*][(CQ/1y ~sBkYji^#x kJT06HTD:BP$3j$ņA;m}/ׄ&E$ Y獔]ty3D0QӔ#=V{j$Dh96O;&6 WKP+(BF'?Hmɽh"KwFbr*AvwA xՁLM!!K y$T ʍH_[㪶00oI)W/DDkH$KexL'=<]nFt; Ki3&% G%r[7^aݸcbtk+K 1(&T>Dd!m?8{si#4tC$^שXz&}E?LgSBE(Tksj [4UytID9RNА2 %FȰ}Dih0]P!́)d" &]E=A)xƑ|87{t&GO EDMCh91L }m1DCXOfSj]7ݕ(}rČ3);i ǍMѱkHQtj79$D-ܸ`Wsoڍ61"wH=*4zDzS70QK袛)43u"HXHTȊ'q&I#l|!P] T^Q.O!`XbTBg @ݪD#򔈖(hJTUi85NDDS>CʈBA>J PBV(gT4T8E*S QCK(q d"f9R3<&1jGYt4Ns@?յ0_;z%F$Jv ,x%7MnC!>edYWi0Do;,Z1\GKХ جP q!N6_ 2#.-IIdI oJpeM|Snp xX},Hi:6fYh2%yMpGbPA!-]BJ@G]˦(1Qj}"~c%zbhHD6٣]W橬DM]~ 8 VK7 Qܸ%)P$jVo#o/%+DKM` ii:2Kd DΒIe=JNiB'/Ө%"1`($Me>T+"-uz7+u|4BKVhPd2`"o0FaWJLRL)xtoQӇ|ou߾[| W___&nn8sν_w;x#u?;vDӴG}Ƚ1a/W|}H;AgFf `]/!J[!)ﰅ5uQoayXd޾%fݗD;(Ȯ*<~k낣 RBꚀusý2X$$$nEշzùva1*2[[ᵬfG3Wk#PŲ:K75i& X}-/z*<`;|ΪGvm#hy۴pT'HgJEFH_a"}#_booixY$PܕS:Q#}v-CݛFTi ?(8҆4}qhn6rM4F^D\bߧa}UbC^MyܸX%JCyLVh>,s3y8mG=qO/n֏*XK4 L-N7$VxDp!^,OX]_?sz n]I{LCF.:ㆧ83l8ei`x؛96Nʀb;pUz!˲(U'bSؓl6ac>֏7y{A3] $ں \0NBHCRi57W.嫩݁w/˺~ #czi,hl<}иR̚QU6T~'DƂcG~V=wdoe)˵]XwºiL`D ,)CWm1'iڝ\bԠEF7{&yWSFCkCj]Z.f.A"v.Eod{C3"j4P[wcҧ ^E rKƟ^H$/4z$"bǥRcs':z]3l-|%Z_TMIql,s9Xm|; 0Z =$3jG;mٹ~Ű=2\>8JeYН/g;vp)-Kr]B;=w'?1%K-aR%HiUUqm=U=ض^'`vk7P5%ej ':}n_嵍d)zb9 yWEq밹۶Aoh}&K4GzkqӘA=c20k4meڈ|فי)XoecS??"xhF"UAt2{߯Qm㪧pz|g.Zd/Zo^ܐ X. r,N/OWU~7;|5/:t%EF[*ҌF~p}^iUQEl݈ngU#;_Mv"μJJ>M/$ԋ8\޺O(oX0=po>̅zcHj<3I,΍҉zύTEr|F>AC,[7XG*>[ϞP5{r0^ }|I0G#FT,qy"g2K}6ri<>Q\C^=>rwR|B#z#Y4ίO78+[[O=-3g5p}{ɕ>2}xnd9'c*z9MY v'p[4GÙᜤM/!]?;k78)l`7> c_ڹCj|qM諀.WNQ^u`I5~ƜT4ݏ$}&mb|aS+M׺ e?w+ב'wo~/4f endstream endobj 46 0 obj 6768 endobj 48 0 obj <> stream x[M%W亡S{צ 3Gc<7'wof0SJf* Bq"3q^Gw.vԐ^ǯ~u??翸OݏoG9Ηz𒏘_@`}1~O/M/ Ëy%aP Pf,  ֽ@< CIW/ZW4e İWnrSWjrAwqPI&M. c-[F rnP4dAPn؝݂zdY (U5*PT/j%ى8 0 *UaG2t Aw>A25fS(v)Cقz0v jpR9 3@+ %R4A/ e&>:G+cOLW-G;ddwW `Ymě ԙ Mk_ .<]ڌ.H ۆUٓ1Bl $\ U 1ΨyMkjU0~YIey" PS:Dii2c 9$p)}h57I *"U,lWP^Ҝz/ qU9"Δz ,X9 `]qx$]48l^{AUWA(*W_y2z!Zl۲XP#W=Tk\Y=<<<4 pTe^)DfhܧUGKz͐2 ECtWeM*-֞/IŬI\e@bVd&d%*q#WOpR Pl ze]ę%&fE%"%@ 'dEbMY+GG2mƚ0w$C4̩ʉCNGUAU3Z@ m-}c"S4aLл&<o!# [@qh֛ltn?ovlQ#GvhߎyR=m[,=1R= R'T=[Vm 4pOqsO7M")rKkM{KMIYniz_=ߨ$ ;}X#"S,h#GhS0`ݩFK1Aq㕆q.T׍Zxdkvw>1m7}c1o^`[k^0k{c6ՐJOʬlwhf+>}S%rVYjNQ+XqmUf*eU^w*r[LmosԦ#%BfY߽տUGpN,7+apHex6HvB8U'7s,!*`;$ΎA$SRH WhƹȚCQ,oHǞOoyoL~1s02KN wU}+ɂ`jz ^uOz=벇bAOHD05 wT?Z- ĵ~'ltȑiоt28ﺖihZ i).K<.I}]vz4< eS6k5 75UfWZiТV k"A9۵h$VUY|ћ'MKkQk+|H Zyק4zL)dy GLe2CE>Mh@O4#p8_Gԩ}F9#=?jB@Ak}JC H-Z΋TEJ]m "MU^v-0G'iVpUZm.UX6[pa`kt6~‚t6k&*)Nb>M CPap'|gZKѤ ^ĹGWV;Tˇ|\%r R3rw//_ݯ~5u1ҔR}nJcS:'o\)aJ/]Д[- endstream endobj 49 0 obj 4487 endobj 51 0 obj <> stream xXSWٷjֶvo[kU\X_*:g݊ZV:ʪ DYYDrKIHr|?999,/zBODc?#:CN9m*TDjg;c#TvWFQg;P{tjS[^Oo`+(Ԛvn ԩ*sVvj'2kLnJ_\PeV~T$^G6j_lΓU++JY?}NJ_lW@] WG@=W1U:wb[ k,ɡ,L0J9J/)zJC-hJݺu5JBń #"xDy"&GtttXqb$AL$bRĤV&晘tb?ㅘ,1}bR؉Gnݨ4]vW:%]sÇ j@={4;1}ө* t PtW\\\"˗ҝDQQQ|4m~~>7ۭNсNu NN7MM=4WRjEwF,HI0nJGo_˗wFvcaa!-ycU:(F7:>24GYJ "*EOtQ 3-.4 iEvvl[OS%$ܼ5gG _ɉ]CԦMО=!!))1nNxF^'!#="*EujߦMu;z3LK %sWmŎ}(v h^ _cHGsM&toÍS""9s&ېO7I5'N~*kQ)zӌgȨ۷۷j0آՔHy{7H<^#=99=)骑ۛE6&irX՞=ua"*E_t"<{zhέ9:!7K۳l[SZS|Κ="멧ܹG>i"*EOt*qԔIg%")i4z{8&ϋ-[r[Sߚ5䈾zۖ2 mNM.KQ)SJ+i[S%w1sûr鉉)CSat9& :ET~ْoj[Y:slC-v嗶U?27vjToMKfRP]Ftߝ:a6N^SDN+t:KwƳg$)gɒ 7m[lI7fujװaݻWD7gT#.\`km"\SDN!igإrtj˾ȶ{}/gNiRoZ9Yԕ+Lii!G^| 6:E@J\N"@JND^SD@"/)RSQ)) tA䥊N{NŁND^g{Đ!L] t ?ۣ'Mb:A͟t5~<@"/=ʊ4_? ўN5n|kԈ[G9'Y ¸Nq l&nOO\@hgǏT)A:%ZʕQQU@h⌌;Bt?h4/ƍK\6ԩ_FD%'Ԥ-+)){vRYVT*s}|rvwrsxxz{S~p§ORRh| t ) MzG*#͚=!OBv 7$gnB:wQ[4o7 Ux+?Pdj=yrŠgۓPZK:y憪lݺUZh~zUdIW_4(=AOFJٽ P5k :ui%ݺuS~O˗/Wq11YWga!ߟ-]يjm2rȔ{>Y-}Ç%%%+Wܸq#I' :KKK=:qYfݻwRV:s o⟞7o;v9sBBBٳgԾqٳgiK'C^^O?p>>>gϞ4i-뉊|2GCҜ\_[23ΞM;r4iSү&oN}z'Nd>akLJܹSq-/?00?8@$zM{.JI)NO/*ϯŭ҂/NKaWYCBh'/N\.#K*JQv k w Cu\IVV;wN:E %u.^ASN0`@Æ =<tܸqsx$iYMPĉ45i҄4]PӐj[[[:;vWZ3f Ĵiӆ==շI%tv<==kr{SQꫜQ{// @yicL =z 3GMҥKR%x(559r\|qk6m/'OLHzDtC:Z.… I.\ݻwN믿{?/.^H[yڵ+g֭ „O W.,,$Wnݚ}VPZskETUNebgg+tСm۶̫I޺3j_x!4t*Z߽{ϯ…Qz::Ҩq1a0)@gde=j%u?)N$Ɔ[t>}&N:&e@- z::蘲mNEh {ȢL_h aHnpT1S7c_e1SqmݚϮ]ƀNԿtzwƀN`^LnZ =t.SS͚ =ٳӭfh?B?eNZb>ٹs'A')@K̘1_~!!!j$((=$T:hǏ5H%1b„ BO_5P .̙:qD``/~<<<\]]U Yd={VBO\eP?哚fk߾}׮][x2yYLL[4?ܷoH%5B|J艫ʕ+_h馛ݵycǎYZZRI+Wnڴ̙3϶:tS%믿-[{n/߰a Y~=)j ƍ{iii)**5jT[3VbY[[ӧOM*2zm۶Q)))%%%+ pww~HtV4##mu񲲲`1tݻ:]]]iu4 P/2dȉ'uȁj2:-..gWoܸaaaa_jXaIm{I#Nend&7 yŊ>|ƍYaPiӦђ?..N@iLm\3V\|z-s)1SUMu#-Ac~eTb+ZV'SJիW.\ @eرSLL{m̘1ƍzꣷ:e}FPPK… ⒒ʊTU2;5|}}VIJeˬi%%%5;AɴǑ#G?֧:'̙3T4W'ƹsfgggffRɮ(S ϟ{դ?mF%y,--BCCTH| ?В_~PGddӅ`[rاHmR˗/KKK޽K/Yll2[ڵ+555++1--[쓙$&&nٲEPcF=k,{jǏ;V=i u*mBߩA(٘OOk_~WM,҅Ʊc,4@өxyyQ -ejh)S4h?m4'SNNNϟz:}hOH^~1c=tٳXZZ4Hh  fff~mX3S)h4t :FN9s\rŋ=VR;qP-2嗩S-OGMJGfo*h[)'jӭ[:hȂ$J7zW7j癩) %ϴjCN$t)t@ @B t)t@ @B t)t@ @B t)t@ @Br䮹SG>c߷!h:U:u҉ӏcbalTh:U:Ν6ݻw7eqٹΓC7S{ıkWY~*_)ԠT:hlZ$Vt:&_|9b왓4}ohlX)SS~05;t@z,wn[ T=ST:ǏlxzHo| =jؘéqpczܷk=u`J?nr;?wv?ݻCMtGw˖:'~ЩN:NC#n[s=TRuTNgLhb܇dH1|?Y3&EH(9m~۶t?*[`T@B9}r'zz_%f3ΙmɐLcnj0{т,Vk1*ݨ3 h:U:U`WZRlx@ Щz@)-H:20Pw6030pR?* <*p:E :u'yNJ(:WiBl2-W_ͬP|􈶊/jyx\4'ƍԙɅM}S@ ЩzNdāSr/+UӼO'iЮ]ы4رn y$?z< Cu5tzS;KEU49?g&thj?/W ኁ Y-ڤ -lmfFWi^Ew/\>*:u20-Z_h030/]zĄT:utWNjT=GwSk1N] \yG{WUqGM1yf.-[~u7߄o6\tZ^ kiݻ_i\3U4ŁN-~l9ɓ~) : QQQϟ3{Xy_z&7:bwoծWǷE~ߵkZ߾LMp">ܷ{ڽեi [b#nѺm;.9z=]sgJϗ]_QaqQƎ.;k`(3gGϑ)=_vT3MAS=̓ +^B}t 7m714yN3q:Mщ-~o裫jppĴ}:Ą>wuxS78% ,GӶN)w(򏏺#Fpr2qR<ͦGD H] 9F~>mըT'&?Ƿ Ux,ܗ&.ժNu;S~ :;Fr\XJAvE#d^/ՔN5* H=I ] "jȥ) t "RA¨hܥ0* 0Zr) HV] "Rb4y- endstream endobj 52 0 obj 11280 endobj 53 0 obj <> stream xlwpף-\]e9FDXg4sέl&ݺf3SB˘d $_Mm1Ni6LsbLJ -2h{^ɷ?W_?}'ϻ} JDDDDDDDDDDDDDDDDDxϿgUg^rǖ-/ 8ۏH9ВKGۥz)hU3S_xZ2u{#w+EZvI&G7&:^q{Tij鲋Ub6)x];c6~pW3V;* %u؟9Wͷ.?־~cͣo5F?5o'/1t귮=ڷm,M:wAJJ>j٪KdRH1YTn(a}#+xD\z"|qK.ʵ>YgmDee#Dԕa$ֶ#m,H%x{S&ӯ;E9&bO#a_ ݫ"ӏKѼ̡zE 'U|Z 4-/tD4Q/ϊ |MCm\5qzW 'b,5SMGbCu9K}Vi"?H<!)>р9ٮ7dG|X/&v՛Mш&MqшkdqD|ٟĢ~=8\ps:ȗvǐtLD'_VQȧ~gv5)u6r$.V"5OdN߭ 'oF_W;X$o^Y hY;>4'>syI-GUOݑz4ÿ ؞[tɒꪪŋ+**- E"FII l`p@oVk{msWSOۋ+Q?ҌnrXg{,I[Ĩ('Q~SQNnmE9bD0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`Dn"FmOE9E=-&(MnmE9s؞rIEԮhB] U|G)5P{g) Q:;P==Mljw O`M U<^BI}QU*7yB"""""""""""""Q[C endstream endobj 54 0 obj 2123 endobj 50 0 obj <> stream xXSZjöuA{TkU*½?QP%**AAD+Ȟae# n%W!$&9ܓ7܄V-'QתuSZcZΕʼn>LNՠ8<ĩj/aUiMFkr4NbQHZad져VTSf+6;s%:6{&1NENs)wlElf(>;U5I除KyUr6dV{>ɭKy}egD;,Te9)vcG8;+qBNO ҋ.R~`9TQhcNktGZ6$ғbÕ{lU5;K>qoqsD^.¾vv.˱zVNoVد{fs˩bK\z@\z**٦c=HT{oU[+ PGQV^JtSĩ2_M:PeT}|^Cb;VJӪr|tXZl/Ux =YԡSɊuOd\(;TљR:ɼWzvZջȾv~uMqNҳ/%t*+~.U4C_d_\OTśuA+;A90@됭S {Tu픹)ױ H\iUju* J}\k>_OytdTlIM$a䙝JIhU:u)^bJ&^(!c)I4c%>Sg\مWu* ޛD+שB?UJ;K]ÔpEJ'iu*Q?%N_I];lhTF2zH>@yֵ̪UK|ٲ"Q׈NU`TRH*YRtRPtsJ bDĊ!H("IB1REH/箈 ĸ/"SDV9"rD䊑'"??@" E<ѣGE Bf4%ST; }ʕ4OQ0:k׮a P蔅)gdd:e)llll``SS ѦE\?K-:e)0p=zpDtB:]t@ѣGq\x tRPP{Uƍs5Щ *@6Щ@@rd t t*')@6Щ@٨PYYYlI^^DdB.[VZM6%2%cƌ.]!8:F:W^FN:U$64'''??=*00ٳlIvvիWϟ?&''{xxܺu-)((v횟߃ߤ$=Uu^ )@6iڵ;ydIR_>áEhj۶_~ٲeoV(Rȑ#ɷ45j?ذaC'''*ܽ{7UթSƍ1J>|hddD_7ׯ#G[ 44iN:T۶mk޼9MLBj4hShѢMY޽K\z5_t)K]vѽTA9*m*WXA6m{CBB6/_N۷o 60aFa*髪:F:I#۳gӏ>4:tG?ۛv{i.ڹsg0== hٿ:;v ZӽoftDmڴ-mܹSUgdr2{SNJJ vJߧ;wPaaa3g,--.ZGEE.~ݻwĉURhZZZFLLLHk֬ato>8z(O1:  /(:; uƆ6 Dk|F'O5~pppBB„ h16f^QիvvvӦMɡz ]tɹgϞMS_fFګWׯ3 mۖ楙Ν#!CSlԡӘڠxNI4դ)kڵi* tӵaC:sr ʌ[ӧ3Rt[6gNLW?GNQ)nnz}vv5Sg&$PIΝ̌>yy|,ݺ޿{e6? 29ԭ,2>gn2:{{wΟD@Nss3&9iiTBwv 믙r#S)Srٹ\=1}D殴[g.˼yTrϝuoO DSDN=i>I)i4zynޜ=*3.JVv.w&K :i8j%":$_Ja:%[^ݛqO>a s32$fҫWVJ mߜ2-毿&[i{^?Q")a _|,VrL4)eykL&̵Ӌ\(?ssJJ:t3`by/"¥^=7N:ԵaCgT"':-ҿ2I)gByչ2R-*;k렕+ɖt3^qԭzf;0T,,?juSD!ikyKЩ3}԰0(7p2f,SZ@*K+Ntv^vvC}:@\@N] tpѥ@N] tpѥ@N] tpѥ@N] tpѥ@N] tpѥƍ"?:[%KO_5n_afJl:-yBv)06f*L2ED"#f4Nt7B?줘¼gOKJ^ 󪴔I3J1B|ܖ YNTb$MT?`@vrݙE#id6 ߧO|AM*hJ8cJ5!mUR!P42Mc:%{OxNxժS:e?2 TV&5KR͇(MhfQUi=Sapݺ*^}z/EUժCuRI@uiľŏUfYj*먇>>V:- a|:Z!ˑԭSߵϞ(MQ` 'ѪV:}~[gJj,GSN3ScKžW?fjաҗ/g̴UI@uji@U &]{WN8CCNj\=!A%Ojդ{7pAG?p t ݝڵA;šդ;w|iUU t Y;=KMUaj6mji᯲jڀN7b:uRmҩFQݺš:N>P↓TN,(}H3S|ӹ3#-K[)x1[yݪ~{CEl"wm֬}\dڲFذAU4AhۖUgzzz/\]]wq [R… ԩ3uTSSӺu2: -iϡC6mt޽]vmժUQQݻw=ɥݻwm23I¬]ŋ>Ï> o߾MN4hpQ*ܽ{7壺//Y ΝҀNyG)ik榦gCc[l٢E)Cŋ 6ӧmܸqQP(Ҷ9mt7,,[lB{ưa^6Ou6m26y;!!!%%gϞ;wB@@3,xYX:{:uX$]*ZwUŏ^ȨE^uzarZ]4:ڒҥKiM---]|9N۷o߶m[fJ淯D`@4ΦIhhh6q?,C5(&Of+F*4_x~KMj׎1m|:gBZ˂w>F.]*8w.5#Gup iӽAAO:zZ u*q픁VmڴiݺGhO~䉝;;e.x: e͹yfq.Z蕘N㏯*N'LP~fCJJ26lPMpÆj}pM괌c[ׯֲeTݻ@o(}ٮ]vpݺ26ԱTsڼy$&_eNYb$iYMgE1i 2a.Vhݻi{۶m4ŕ)m3&hٲ%SA͛wZXXP!M?[jf}$:(0ΝǑ4#癙4A*ybXIQ@S5z9LB~ɓCi⿁дNE4cRXByGзoɓ>:?uzc)"""F=|fg>Ç4A]xqNHCYYY_.6Ukk~ɴɰGJS޴i+w,--Innn={؆to~~1pi:54dBnoc4aBW_6o\ڵ4i҄ k*">,}oG\ghXVm U/M8) =J)~BC6iӰ-jCOY:SCSUV={\ݢE *P)9r$~ ZEr;G y뭄CVЄnik{wժT IR~w/gmMhZ2YJʋ]gz'BZJ<hBOϬݻ'OЁBlVmLN:CJqqqiԨQ֭[jEVzЋ^4֢ڥΙCfjRjCooZ6ZD=[ON7o z$[͚ficG..G7n< {4!qTTqppG>>W?O3KI]Vʓf{FS <<]׻7DVιu+-R/)^^ /5kt~Щ ;H[FS YY~"֖T6|}ٟI:(-M2bMAN%}2Eh@@kal̾ ~ )qq>b1cƿtM&-R)˿rLux t*[g{ަnNA64d&&\7@0kLf͘^ ut =}o&e~>}؎0bQ )fvo8TN=گwQ )ƭ];v]u[t*?.ƍur MPkQ;w9|:Z}~HzS 5q_'ߩS jޜhЩB1Wu[Tt $`?w{ۢ@ qKkԈ붨rlmm׭[7k,cǎ-YDz|}}^Qz΢ɓY9l׏hЩBwגnNHmxVVի={\re…ԓQz_,4hЩBXN׼KΝ`SNMOOOkƍG7oM5icŊ'OrX9;;]N<^tΝ;IL h7''3%$2;[=,\E;N]r[zxxD@7O8A7iI۫V۷ogff>{˗6m|||\ ¢"Fru(%%%w«WҞk׮U3/o7O:UKZyŋ?~.uD/// s11 3sѼG'MAi[Bh"366V(iVVV̆_=WcN:p:U}nNCBBpww'^v\JgΜ•+W6i OSOnnn:8̆Q{%/_TE+ c;r:U^Vb!""6w\ 1׭[G4d^Wzi#00\tm9XtU[nլfۢ@Bk|hu[T ouGɓ'dպp©S֭[us̙3iӦ[BR 3u*e@:566޳grAq}FtWxr(:L/׳ X~ӧϯIp7T5jԢExr---Xd>TiӦ;s^7TߠBϬ'E.3}td(onnn?ҫ!&MZXX(ZPP`bb2yd1?СC={&gݿGt93[yXdH]}tc9&fcƌɼ@Ot+&_ϩO߾}i ~w##j]ϗxN'0HJ 4ZMH1nܸѣG3uVYYY̟:u*׍0ޠS}fVVV2PZi5/,,,̗Ftf͚bŊ . sΥIT```&-h5|M6ה'6{lZWo.\e&@~6inf #զK.ҥK#G|SѣC^~]!ѩ7n:̈́8y䒒~ɡ%mHHۓ/wqc o jCNymmm%ʍ7Z[[k1ZSb̙hѢ}i1Z|>7TW OII Uxx8<޾}{ذaoL4&&T(v &UgAnرc/>ˋkN~cyyy %ڣ|ތ7TW U*=666֭ZSRԩS˖-۹s''`"cAybbb~ r]U:%hJK~qeggsՌ|m)t wqqf\r6kN?ߟ6kNy0ޠS] O@ Z܄u:zA^ rn:m)NOm>uaO叭c87ZA*t(zӵ,4'NcihqRt٨,Щr@:ԵkWfט]kHۓ~f<ڠ=i;tAY_$xSq+aci#-g.d}T ObftySNEtz lIL%*!%Ҷ|cFC7.ѣԘQ(eO#FV긗ٳ#O5#G 3iAS*t(S=9zД+K~1݋dH>lЄGWO"2{Eə̽}Ml^q!ff8<*"tySNEtz~mlIY*Y`&Y3͘r2$ӱcsL֭^I1:%N=OCz;1bK*t(ذKitn -Ag}a9p)MJEG#ys?1ړiXv!hTHet`ݻG]m뮴'MG{ Hs+v 9b@*>긗TIy(d)o^EsT딟)dHFATf|Ehϩf)G cC7f?]eI]EYk-/IǵSN:U=izfs35 '[IܺyEM;hˑ -:v)*3m6-I. ~Y?ckW3G߳:<Щr@?:er:_4Ҙ8 9 tЩN㣮Ҫfqn<:UTQM rT9SENu5,Щr@j0YSN:`@* t gN:UTWA*t(Щ:UTQS] 9 tЩ@}m:t)<|0[hooia<שz:h~^\Bkkkpƍl֭[B:D Nc,Щ:UTQS] 9 tЩ@|@sꔷ@ rT9SENu5,Щr@j0Yy@u "E~C(4Ҫ tʟt֭\19ػu3`7yc j'?E#ѣG\2y!uÙA*lo"i:O/]\\(3<2"M7#@ɑ[˗\28z5 ~ =ƠH6)5bǏs=8& yyyÇy݅FxߙhO[(o|FZNygM7M4KJJf2wq~ؚ~% =HWٲ_x񢨨Ç:B:ϟɚϴ~:*[UԤcʍ4فNРFjooO~iiiMCS\nj_g|oUQ~C)7d:[hq5M=zxn]t:;:G:S:_*JV57r#MFS&1_zUhxIBcʍ3 >tS8uzPx`N ʋԼc'wPy/d:sRQW#C. GV͹SVYڶVIA#C/E\ILxkcݹ趿,5Dcw4`J>+uz@BI1wh&)P]ؗIZD7JGu'.G3N~vmeCS$YiݺiQW9of"&+%f8Ç@҉e'᝿1 t(2cJ'Zh>7h*)hR.;ܩSy-pT" ׿Վh,)D~zW/.mS3=\CRp nP7iM0ЩxNMN= t(kW 5ny$cfL`GEI@҉[)[W)8oRގ?|Џۤ޹y4IV fZ>Om,0 n1[@H #ѫ4L,mqi zӴ+ {GvHgPN$~&%x5z}uTtl{3RkqKgS,gSDUp֭fV:Dk>1nE$zL Qwt_ >̜J?a??uRUSDI!=6>Ö2Zejn &!Kv mq_w: #-*#M{F 6Wta1Gcg-!X7?fY$;HwF3_6z E{NKrޓx`3u&-(-w7AWDhm?/#)WOZN#}靺uk SMHQck&XvAu9B. o"{Vm>x53}B/#Fѻ Y.?|mhI6jn3z"IׯU`ln܏4:E48/;z`Iz ^hVM»_٘-˒J:MuT)X='zN(kk԰B͘AUSg\'w%֛r߾2~bZ“f_= VާI/#zu۰> MD˜tnZ-3^sR5)3z-i>m6iL'B).sܢt3&9"+AI{peQȽa_~ܰlI*Uurxҙe~W- AH7_Ft5>ɴ꧷Z-ND5s-7..l*aZZ#!l9p҉KɧL@oj@E]vaؙDT95UQQT¾Dl9 I[%ݐtl{]?DŽ]_SI?xt+B#m6^)Maf"3%a׺bT?# t o"zO/`DQxݹң)1n_:,z6iўܟ>R@"/o Ȇ bNI"s:MgC LGoK'"$ۆ} C?n#ׄd4΅~Ѐ8?5DNy V_2vt*uPq>eA!tz?56=ї3E$l07̷K:MҪś/ |!eg3:uTu7g *H7s0D'Ԡ5f "r:u4bΌ@OATxe7¾"-N=:.5@xN:1e8ѝ-2zP ?0[h&d9ruڰ0'#6 IO@ά];fXVOܩWa'!u);fBғnp~^F-'4ןU5mv"H YR\[sf#bL7.[rRVXpBD!oUO:e4(ߞB9kaU&Ip|`e $U5/UN7LؿSu?563] ږXeeY:Ǿn-`1YK5SӔiZ~[nj;CJ?76)TqR")Ӟ)R¨nGB ;J4ft0KaTD#SI \8"*r)tp$tT췦L:J0*in?: S ] "iFs()r¨NFZѓF-QS=\ "iΚ4fTVBEZqKguySSfD .!!|-ߓ S t rҥK.5w\pLZsqkXb Z NizıFFF4AUy@޽ԩSKKK:Ç:uRS@`nnn vZ:JMM-sΆr-Sk@ݻ<{|Z_x=4$R ȓyyy2}6cwﮱV6bhhpª-..0`@Ν5$FK2wn޼ظP<((L?r*FHV/yAvU@ҥ ֭[l MYkh+4ׯ_qq1m]uu@+122ڴiӧOe>(MiR:{l|5&dԎ;rv[ endstream endobj 55 0 obj 13957 endobj 56 0 obj <> stream xlwwvQ+[26 [2M U6ݟdō:F :L(M@0&(XCq8dKal-miݵ\uJh}yum55ڞaؽ2lU"cXyAd@7ٕ'cc_1⠩1;]nYvB{啎 YھΆh$->%RJ::oRYd沴cwNYnmϖ,07ȏU9)r'Su|/Sf9erj ) 㨔:=ptF յ"tLjF"N3]T$&sߒS+ k"^ۤ$[;M7LD٬3eT C[ vh;dq"jT)ba|sm=fwvG"LDǬ+Iu^ ZzTJC .݈/9.y"#WH4E4w"ed5Cf.u?[t53&*+u/:O4{ď FVCS7A=z&q#>.JJ8AҖ2-*NT J~W#ce{pjԽ;U<%d$=e"֦%3ػ#HʜOIK-SuW&Ȥr3e7_dHVIzܩFxv鉑2|&H|MdcȽՑ W2D4} ]qz H#%mI]^HD=8'#;mV; ,q_IL&}fV>ʈߏzdʺHD=:7wֶryaXP0mo7盺NźλZ"x=O7u[,?%Ζ/%(lBJ##+7C]~Kp؂\c̘ѣsrrQ2FzzpF 7RSS}޷a+7I"'&QdAۻ7<$5j{Fv;8$9h{dGw_#Jlɏ(^0"F#`D0"F#`D0"F#`D0"F#`DRܧ\zo}I(uDa$əƈ#qkjjku-}[Ljju]7N~`]HktJ@pvUOg( NԋSGc{J&c{DKõ< =6tpj{X=;x2:;b6lζ=!;_<ܗt+AQ*}l+bE,=ť,V\SQ\rcE۞P'F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F#`D0"F+PƊXf{*KY+Ǣ8xWĊ/\}"6g۞+-#fCrѨ|=4ZlONmOu-OCCpm U79Q<Φ^VxJ9^6T8<^΂NEC مۣRLUu}'n\kp< &:C0u*5 sQf[öxzcQ\s~CQ|Ztk8b(^GP|`{$׻P=]s}D}B9g{Jȓ0j`Y(Q> stream x\ˎ9rWuII@(@5 {'Ci7Ɉf[UxeΓ #b^O?nxk#~/?kvۭԧvk>[ޟ-/4SRA?֎Q ~4vIrK咱%M;%p'$qMe.KR%uS }J%.U|I]\ W;eG .|iiA9JovYe\Y' 5nb sK5:tu㥢\jͥ TR.uR!k|]}ė}޵P,Ѝzk~\:$;tU\eĸͩ{:]JotUˆCzgKWMm.ϭv\!Ld1UydrEȩ&,ARU.]ZXbdXa.4b똽\9 GZ%J0ƍR; n"'0xΡ#2Fk{VI C,vIG eK3rOOYp!.E1Z6CJi\m5שsuڥs\-x}*ԛŏiwWӗwOuR!k|)K}·AXK}K`\ IzK'B{jA Mtnc([KH  h6J.̓EޔepHnEr`qÆwϤ/$ hM.[A Y"F9znaRÆ,s y>"ڷa5jPPZTiԺ]#\~`*7!.M;u'ZVΗj^j2bPdYj9kIŌCW蚜SPX7sJ@Y Mj\\=wD#LHnj2.W܎[_kh'CƓKf/ .zM}~R7K T2_&hȂ$#96OdRn&}Snҍ fJUJ.4u~l+|hUZ$ W_QВDs:`8Ti1:"# U(mxD`;ʗez ,(2`)݌.=zP=PWԘˮ K4D=̙ fmpj쨚60+4V“~k tIWStA3n f%H < wwurFRŭ.~Z_7.I;{O-㔨I&zm5Ńd'̳{vU2t:SiؙA$zj&5κ4>x JbFzoX ְJ|Ah Cd6Lqz\ iH8"u0視Jc%Lʛ+ѡ|R&TרWSD9߾U3)cQ)NvIw ?n2.Y2LhGU_p98ȧ\l1~7N"% $9J319z6U,".U"g!u&;{\CTrJӑJ+Rzn]ɺsm\q4e>M)] k'eTih9;t6O1#'ik“qM\Dў4vD`b_`fidiV4uvсY0r"8)`CޤtH+Hr %2dB~J{B ]*uF4n:9lJ݃a#_nзKϻŠ|),)!f}ly 51ic 6c/j PԌ6VJ5ӥ?IoQcm= #q,M/!u ʱOf:x)+#Ѯ- O]M.=)۬XVЅr95Fu0m`ԉуb+lZImW% zIr^C:$gw@S]I$_ ZU]Nt[RPr=R$\$'FGj%Iy:[|Ɨ8 mBa21}.ZU![ =~c7>*S1ݏ鞚}?Vk͆7?`=gϞٷPԕ zp0K򐖤J?(hVEWg?IO+Ц,8qfY (6b8dl I$b*];:f57 V傖k6?;EA5GCh&f5mj4t#рxaV/sAy4MAOpVwI &7tL|vUk?n_oNo?c?!|ܿḱBw1~J/suAՈ}(S{.gLs8N3wY?/(~{?&x^-WÙQLqv_SE)Pj-:p5 /zfUʡ.}BWl$EܮƆ%,ʶeE#He8džs/"*6BsQXMDl,?qUci$<隮*~&̜Wݕkafd>Zy !$lsNs3_qg\~g8:lu56]3;l )r.fDQVw̋e}*.OxB8=] i[#/!Q,v܋:r/cϹ+uwg9ao1v-c}W|@쀽YT4\Mt a^b߹.;}%>N2&,xF:'}upSvFؒuD"ȾP@f;S]YV8Ի@v^Y !mWs6VޑV9ZqΛ-[.i^bF{,8.Tboo{\l4מ[we\v6Fڥ_rq[SKUX ):vˀfdT,Юj5z.,WۤF:u~h5H\V?뛮zPS")>_-"f\d>ϩ+oL_9VUqk:K6TjYR71+RQ37h.5bLem">hk;#>kUz-<ZL} #2Mh^9Ve^Uoʞ/e[dvgD,vIquI[4.O_SH'|I%L쓖]#g5uyݽgigNN&ZG͂7Q߾!$ǟ$/}{Aأ7^`]ң7^ū;~ޝ ZOS ??ÏぶB"?P)̯*.T%5/jED tG?# +ϳQpS+;2caT`“)ɷ;oC2}Av;ɓLZgѤ5>SuNm ceGx> stream JFIFC     C   '%"   M3"aFfxs";E+=w7\x_oE@||]̃@d! w Dғsd~oϽ&hfq%AI jcl?u$MF94~{?jW>Ql{[ űkx"܁MׄS= ؔtlul ݼetQ4twެ= V9s4vt'dyn[]v[Jd5/nro{|9|O lͿ+,zSz"Ut~ot̎aεOGas=ws--tRW%lp N.kpsz{#npk~ |mv;9NNn.V7!nӯo7r,}I;/1aطleWi卝`޻9(dC\ޢ]-Q{@^DQ{@^{Z2{hj,D~2c~XaL<֭C{A6 -;:){{vr>∯v.tn.>r7:AnilC;vw;Stc<8io;[U1'GٮLFj3 \x?Oy~Dg`TNzC!7zC"X?ڋ= #H,x2Ss|Sh^tFfUiVafUYy=8$+ٕf@*,ʳ vó =?3Oܴ_./IWKwMŽ^aMx^~_d\uƷ;p剮&Ǐ?UXb,H+Ċ",Hlz'o3C \48hcM +ε> oC;%-/ 9akƩ=ؤU*]].Fu~~Ni݊%vSv<[\ȟ5#,\}$]~\!9NbvZOv)=Ujt 71xp1^lxN `'ڤsR[ԡ8XOc߯+ᏹ,} v[Cw^3nkdj7zGWT 9ɾdjWt9Zz1[ 4uf>'0iΎdz ^5Dmru.*Uqj\ZWUŨBҪд-* JB}Uqj\ZUZVUiUhZ_ڲ-BOVUiUhZUZV~UiUhZUZVUi~ S8%߷b,7 6045!#$137@"%2Pp&G`}j&]2m-5[nnw2[BtժE*+p9}#"}HOri]ՔT3LRpS֜xDmK=ϟG[ZvU%gHzP-$S#RV%y"&g6&e>zt5MW;Ǡ`T.&9w!֜j{3}#۷M!c4G{_e&͚1w^KyI@zR]8YWnf8v4~i4АvD~"R ff$m}zeBJEgM;0w!Uʹ"bƠQrnwOd8A\a;_;z9g%I"ny3ZȮG=UO{MMzH92>ӡWtz}ҨG;|HLԶTv.^[Gt5x`a 3qhk>,I(t3N-NuڮKBa&gFkV,iVhelfLZ+Kj8<%XY8)8luC㾈k"eo[ȖZ)C3dh Bdޫ4hB²#UZDA)ŽWܮcdWs ɽB#G7;"6x&-j o= oŢ"6(֧[PtA?:UJT]GT*tAҨ:U<*PtIXU\HT*"*PtA:ƌYNAҨ:U#6IUt㺤kSҨ:Un w2m:UJT*P?t鬧JT*Pt?;o߲~ϭs|}h?>c=R!lXdr#G,29a Xdr#G,,YwKrһP&]9gpʙiY I`#G,29a 7l#dr##ڄPYG,29a Xdr̵~pG,29`S/k129a Xdr#kٕT|Xdr#gd\OWG,29a vtnQC,dxKIˤcmEڏk]f^ݻ=yxcfk_7d'g1ݳ7;H}Gm e3iOٲ {sE N>[Tf=hrJQ`u?1hrcD̝EaC7ߵѲfec.3qˌ\f21ec.3qˌ\f21Zu'cfK1ec.3qˌ\f21%QI[zec.3qˌ\f21eWpʨ3uec.3qˌ\f21ec. >e\\f21ec.3qt;*0uo 4tuLՊyEdISf^VMy,nu}WMZz^fYwˍx ^Sm.Rf[H$ I߹lď7+S{kq?3:s` Ǘى#waMǗٷ~~YV+4t}e^=H\[1[1[1[1[1[1#aa`E; ^Ѯ^9999'KfH?!G!G!AҡoKꬮy=A!G!G!G!DSTWq)БfHmrZLO XYsBF-Oo[ ܱ; Ym-dy8TZQZ8%w&qrԹM(՜'pd4%j6ؓ,LL&[;rF}ܑm?mx#ViW AD'm2!iJ")٨ҡtx!dN#s媴-(**V!-GA-+t/ɖkc=-EMQ]TԡQМssPsS}?mx#ˇ,ޑ724)0qlyGtJV= Π8ZZURrjQ!LN&[ꗧXỊ*=*NR|PgC֍[_]ӉדEE Y$]ʕ)XbU[n~ gdy?p*kIO Rt,t챷8TJ\A"XdFm&[ꕯ$#F<KD 125tb.ؑrׯkwKJՃ^J e W < =v+h쉦[m3Wn<ܸM-Ft#M-%94mȔr++U챩]ΘBJ'I~{9.OJZ%QJ~Vbj9:F=yPxcҍm,MjdP9u2vQGi*q*ӓfJ7I*sgFW|q^.C7\TB>ډ$/l(3YH֬ŤkVb51i՘jrǺ)Hhe6h;E)A28,:Y4ZFf-#ZDc1$: FiX%2m(*Lb51i՘jBē4 ZFf#)TRH0 fғ;ZFf-#ZDrמYH֬#Ii)H-< !A@Ht]CvQ+(I3'gkɬ@Bm_1\C*j9dY݉%rgAi'^PmU˥̉*#JEQTUEPd=qdCJWHg-ugٴY%}o`f,r8Ǥh~zC5QbBC!!!H?H9FV߰k-dE1 +him FV߰h}aۨ4wGCXw\WpJaۙwht4U*qpx/\bIBU[9*8I6 N$ N$u璜W'GoG|T?E|6vx儻 YH<>XBR- ghEÍH3D;mn$1g s6H5%MAQRD*Hpl)MwXKՊh/%$Ioy N?U%#"'Btv=DwGCXw\#"[KU4%,ib_@=S.4JD~cHr~bᝅ4}BĶHBs%D9p9 P˵Y8Q S5Rfs6#Z`H&yT*5qnFƸ;(ɴb{QP9KxW'訥,Vv~+I;w ?Ni'ngⴓpZI۸Y$,Vv~+I;w ?Ni'ngⴓpZI۸Y$,Vv~+I;w ?Ni'ngⴓpZI۸Y$,Vv~+I;w ?Ni'ngⴓp.RvمLg@ !1Q2Aaq "34RS#0Cr$BP`?G+q4' }Ii]ks>IY?Vf%Zƒ=5eWDg)qn%WZ`&QIVZ3{]hֈU ]ow$߿F#C:4-!FΪ^)8NIkw ,bÄE&k1p7rvZ;Z =31]Iv ܝ6zBƒZ,:&+F!#ŬVc{:\ISɗK s^݉DhR4X,6)L4[LF"-GM@'F.VLn7riܴZcw'IGTHvL@լ|CLn7rŘִNJ4b%Q7riܤmwIZcw*D4nL*657r2O7rpmfӪ\[e7rV˳Pڞ#,Z7)9nRz;Ut~(˨}u)sNo))]uzݽe6 ֎ck~b 2BA7oZ ԬF $MݽhnޘQt CvzO.quֆꝥTrMŸO3M!xX i}d(uEŗ :3Q}L1/VS;d{*"10܍h;UTͨ4& jfFݨj(5$vGܞm[Qˏ*"GhOG~3__drS9?THMvꤑ0} @pnttuTڣcر׷l-?}i>C%{)2Tt߲}e`!-{>߲}eKQ 3n? ) ۥx|{>߲aT M8 }b֗5*JeP^>ӱxN+os7&U3^J8x5c5ao}|Pr `p2Jg=& s  iԬx#; ӰaQDU*/?Sg Q̮^2آE¾m>,-c'>{cTOwS7lTp$Zw i6wڌt(.~łE]ʫT^ @XܱK{e,P>hehafЄՠgWfÃNڪ ٱhALkTrũtY 논MZ;Fz㵇{ '$\ W̔x< Gc{}h:J-ֱЖ2uTLT^ 955555555555555555555555555555555KT !14 "25AQaqs#3r0BRbt$@DSCPTcp`d?.eIFԑj9myrF zno g-VoMnw3@$M.-]EL& I|2-.ڄU4L~̷(6O%9v)rBNdKCRE6CH˛!l2ʥDoI᩟GaI$L\5$R,8>Cn`$Uv9(ZF1Ҋ%ʷ 2JҾXYiYW6TelkFjϠ. ز{vҊX7?Oy[(Rqf15lף^fz ^Flנ5$fz ^FlϠ3$f >!fKm)10.6V*k]}ҲbEU Şޕ) >ZiCEOV*9-RͥnsQ,:+lɶʹc8 kPxB5uvl 3%~% *)$ *_Yz-FeʊٌMbMQi+N*]4;4EW,c]"σŦEU[h M3 BDK6 n7TmhUȼ7C6|)TcgQ=12mqRà R5R[.1lJ`RBeZt8N ˙#tU<T@0:6z$ۢ-6v^}~l\E:%mJgb j_F"*W?RBW6ZTCl(-4 MJŲD[ mR%@ȃ#j2i+,mCkLWۥ[r5i.,-Hin1b_Z+UO&.w}kG[@LYXj)OVV EVՓ \joY"%.ԇ),/4Dꄢ[էҰj(h% *)[VT'[ 36%e*%v5ā'& h,DM# ,O4nW h֥SwzڕE(Ҫp)U,U\\Mu )R%Z&[8khRJw lޝ߶QrA+H*UH{%\޴O&'!h=笰u](Cd{뀛7J֓ح5||@oTT7/.4iA= ʓó,.p/ `UZZYE@o,MbOg%8’FᤫO]1(ʰ2[ O0lx+tKͰi&qj ".E^Hu3dڢ!uنXbi0ց$[HZ`7k2aG%meu׈<~$ k6Bp&uJ0ꁯO:0ӎU TljrژjoUl\tOhRGǜvAX-$m~HK ٲȋ( ay9mDd-4LJ$Z'*#/40՝Yet)h8+ubhgm I9TZDuėJE!نKcʫJ7VS{0zcM:(u(# 8O8T/Ka`I$ 8"IǸbW~~hAl[剾u>w *eU Rp/ KK8ZVMHL+Iuh㱘·oZ1AtQj|G(#u7. T%++FdUK|QA 2qPK!т733.v@vaFm@ IT fIG8;{;1gotf32jYoZpFv@vc;{;1gotffN)R7?kOzWLE9'7ΧbSv9,K)vo/t9ί5^g+zٛJ+(WIh-1Zcu'=N{AiԜ97Rs LnIh-1Zcu'=N{AiԜ9$~~eAljQv +D3_1:,6( HHIh-0.TSKvS$RZmt *N((Ih-1Zcu'=N{AiԜ541)S/ aDDyRQ0%Zcu'=N{Aiә}Ƀ8%%%miBZcu'=N{AiԜ97Rs Ln8JnM^rāʾ@m4J+K97Rs Lnu'\PS5ӒdYXIh-1Zcu'=N{AiԜ.L =]ZޔӕaeūΝrK+MGWf~_F-%ͼ6Ք+OZu:ìΤ4^]tMsb/0w`l%wOyC:gy>#; ̳F Y'Lrl7H4sCu&Ir%_ukAU|LKZԂ˴TDJB?ÔlgzI6Njup{D_WzQ5~38>?摃밗a}=ݝ\000g2?o-d4k9]D6zΤI`}E#\>Ki?/~ xPuπcCs,H!3~t+[ؓ4sAQ|#bUYJʄӟ9cr@˓7.Oܹ?P:#r@˓7.Oܹ?P:#r@˓7.Oܹ?P:#r@u f]B3'_yn4*'D" EM`c/fQȮHܹ?P:#r@˓7.Oܹ?P: VUu,kqw$y'Dn\0ܳ ˂-+HŸ(`JHBITT˓7.Oܹ?P:#r@˓7.Oܹ?P: [lPHPDR̰ tP˓7.Oܹ?P:# mDR. ݁[.'Dn\r~tF'DL.l7%LtI *'Dn\r~tFX>U0dQR$M1}̖i cr@˓ ˊpbKM䉏=?/%'ClB98\n6q4xRkhQ.I6WvnB済o9u+&>_d<rhlJ9 żdɶJ< aH$0A>g/ߌ-pU]rqBwqeʢvRQ! 8׎w$a)iV^E[D"-ܕ%Y7eZԆB٪םYDf+IJݮ\`BE-l.|ElN@/}"76m80Rf\F%1rW)oUͦ2R+X64ބLyF<:yQaGҢE(6LN-DBEHScbxճIg0ބ6 xSS1%b$Q^xѲӼ["cEvCw J%N(EfU[(; F݅a%wȐ7*w*J~C90RG ܫ=OHqQĖ߱ưMelʫ#VƮYa6ڪ)j+pŷiJU럕[Rv3{ %GdZm6.6t)4|{'IoJH `Yyg\/ܑnIh&|,T;R 6(#"i=w`*SYG(הR3p] G2r;QtF@?I~<`+3{ Wa*ȑc<,O rVKXԯMgOX<]F[@`Q|#ݐ_ZؼO?36JӃPE/U]9ڠ%8aPty`8iX"qkDrS[#UMl+_7(42&kьվ͇cSXfm;ؾBPUS}!LSx{ | O0WDL}y/&ٍ4HKB5]f%Qx]^%$m`ob^+m ,ώB_S,ќ4$BNtjgDe'47x;) d?0WDL}aѭ XV#;Dg}Xh a34FwՆV#;Dg}Xh a34FwՆ  6mNHH.lTQV#;Dg}Xh a34FwՆV#;DKgbCJ*FwՆV#;Dg}Xh a34FwՆ ˶6el95V~rtA,-+FwՆV#;Dg}Xh a34FwՆs.TH(*;vS$g}Xh a34FwՆV"[U;ڳDNQ|#o"pՙ]rY*%THViǩgS*V1hɥ 2Xm>#+,5F g-ٵJoAbV U2/Ȃ}RX2_eVUxlڋ~_wpWbsg2*â(9whAuY~QaLAI}r v'0Y߆j&[ʷUom\UmKU74,>LZrͥ="<(x ybcEu/JM+v\R(XL}o;hj )VԸ2n+xqM]Mx/<<2 X᭨n ㄶAOKK|ȓ.kՋ[څAm1DŽA lZ׵剏=@pmI*EяV13F=ZFhǫHi#4cդfzяV13F=ZFhǫHxCb('8QX,mHVբLxx|\KW7˃dclX͵ohQ!&'[P.0vc3[V bũl:Pژ O!EiTZe  Q(VKry+?UnK]"/,-6TM'%bEot:b͏s?t% *#lM.'L"̕hH$mı;̟^5lˈQUt-hHʐ"%"pZFT^ g鉏=??/w%XZ[UA$eM,eBM<^1F\ lKMjdrWdSҨJdކ{kȱ20eJZuj 9kx_z~#XVKplYUIhp-\%$TQ RNrY[FŚ*S~ҪE˶rЍ %ڻm"(M2e]Z ^sc(OyaKf+IPڢ:a-UMYU7CmG*\VʉE5[xnڦZX"@Ū%. -w UEUm)k#f+?w?bw?t=ʰq$m¥:`PMFh6wm *FbJ;HkDآ5+xnܵX#@)pQo VP]5&Ɵֿ }r8=>0o?LL}|(R S+h;Hu[ !yRva%zMC݅}x]ks L n.7q샮: tXj\DvF7;Ʊ0xoDEM~VwVk4mjI 9ix5UٯD4IוWjII]Obҡmmi?.7KM!-Rasc(O^>h-D ~Nl&rV;4ښ|$Z]vHt]yEhj=erQ2oWyrd26ƒ¬>o8ܫl#uV6ҫM,53wR^8XOrS֨c5VݞW$mUi|M<-+"aGX7m#Ei:)7a[MQ+$rvb_JamN%4qIhIJ#e/THuqIޒ`q>?t>"Ihl;SmI<(خ2ﮋtO7~T^WօoTaDUwT dꢕ=8%LCj3;j͋\5F 't"Y$X,|j70q$AТvфػ8՛LX2)Ҙ*S2jٕZTމPĂUVRw(85`~Q|#ݓUa*yKR< _n< _n< _n< _n< _n< _n< _n< _n< _nFQ>XUʥ#Gs9{Q=N~x'?j< ڏG?9Q?5U,*.EŎ07Gj3sf=Ϥ{QH7>Fn}#ڌG Qq~([ޢǁsv;Q\.~S2ңO< ڏGsv- TSbcEvVa˛/*STZT\TF#jHڤmR6YHڤmR6TF#jHɬڤmR6TF#jHڦjHڤmR6TF#jy`[K.j+KQ|#<'WߘlvHI27*H1uA3Ψ4Fy:T#+@I~'ɗʈ3Y@ bF6"{..lb FlCT*DB"#` Jb{#q]gB ZƦt a^KX,,! $8$ć\!sԐQ/bs3"H⯳9AGE)@ԹGUjEpv!/3[ϽWCbImP1(#IᑂH!H,&UdsS,6afC25gwPUq!2s@臃BoU$ޅZIgEJ.(H7&JWD?,'2q̽?b1uqgXCP)PM^,T 674LeBi fI6ykPU椙l$a`©`ΟvKF OjHXo5L^]V.HZg+c*7C2Jid&I,lĺKpaL(I`p+rF @ d9"n4B]tYu4m4 AKT%?F عJdނTҷ-yW֟„+$*]PwB Ęʰ|U?qŮ[JօԘ8(NSxbTkIݻvсX/V 2ګFا|dMOv۷n"4((0w׹v`Nɪ۷n,'"*Bwnݹ<]R,WiNۛNN02 =mGpAw҉/KPn]gU=2m!azis!A*#^Q(0Γ?KD~קtgDp֏\(b$2G$b 1L(MP,U]AcZڇnszA?p@0]!,Z̠ NԓO-DWK'i瘧L.%};u/o}2&j3PUhXV4<I@7V2t52pwX en={^&NyIo ;x7Txݿc_D%%بVbTaÓz^-RKJ;u&w %2_M婾|) p@"Zɥ'ht%WJiP߸)Pΰ]a<^~վ8}) <{x>٢,?ҀKlZ3\{Qe+6C^骳V35'R^VsXOh\:]+z&QV><Yž(|ҧN򔠐W  iE'xLm /ۈڦRj 㣜(HG|OoP:޿Ŷ+#[vpS>$)_ſ\u~fIG˶c5lVFuP-(_Zy5^] Ɠ5'G0Yl4iPŮ;֧̏[}R ^4<@#zFLuIi>󭏇E_#z4Uyh]ibYE 4r58# ?bSl 뮺뮺뮺q"1C {0n뮺뮻5+e/q@rKn]u]upu2`Se囜9C%Ou]u]uUk0 Zވ뮺rk6;]TQdp$,zf!GGh% /2Q.שXaɅ#.ιs}a.4+Eݗ~sQ˰5"# ⯷z@ K%ֿ4`ѴbF4"#s'2WMζgWu_́yi1Glt`CGd & I MdE.DiJĬgS+s5QĖ^%vbV 3yr-K{.;$k+++++++++++("e=x!q)L.\ei[gڟq_q_q_qLٸ__zWMQ6@B+oY"%_ҵhcS-!Sj,FU CbK샥"Q޴#JCbPؤhWk!Sj @ l?t /;E|i>FcARo'jُ?gم X*Ǡ$3W x8ǽI0ɋ%l7K L!v^G\i:Q*sj[2*1Jރ׷׾wc0 qߏov=j9!N9}Κ7Z؀Z 1XA% U&Au5DjBg24`"3i&^{?͑Pc" ҧMa`a)r@gl&ɫy@-5`@OP*li9ڞv64!A6Z!|qlSs\v/3YP< <={}Z`SXVJ-dq˒ /DŖStzRfK$*DJw.viƀE膍pGзӒԭCw< 5pIh-oX9tV֫ 4y"| \(=En'4·խ\*]wpFeխFR͚/jH9q6[.a SD>tw$9  4%E}#Н"{ҹ)J"gmXiA΋+u>tz G*/! _I9ߕi(RxZć6V;i%/5|#\ n6Q( R )B;qtz9X!$ &C?TRJ*PXoQ0QB:ԡ@́~鿿;~T <Pv{獆|m(?,ʾb;s_Q_Q_Q_Q_Q_Q_Q_Q_QXxȟxv&xvtoG^1+ cRŠf1\::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::L@ԱEJA L <<<<<<<ݴ>s<9󳘒<>3ϬH0¬ 0R0݈0AACkAPM ?=N0>ִ<㿰lq2,=o?r,(Qir:#hc"#l3=I˸'z2--k bҀ#{RHR.޻4+DQ"Ҁj菓]}e}&"Sєc|P *-؄=zIr-=KNC>}o7j~WB35'V{JuzAԔO2Ez` M=(56>9J攥dYOE:)$<h8ܪ 5;?CGdOZY-` [>a/HA0 wC,hݐQIMJCL! qؔ|aEu_wA(~e<=2T'Oz={Y 1=iz"ؕ&$JTf7εzSJ(f]tOOM$=׏|(I{5TYu-O (kYWYVci&<w #⣜kh#dTM#bk|Ut-Pܥ$r*OS=gҐ 19eZ\ h\bLbѬhDF}iJ+kޖX^%Y\(n6g+Sa@J%DІQzji?P294=;)aX xO⢦Hz%KmPd1JAB9ȻѠ@$B.օR-nAa+(nޣ@Uԃͧm(x@J`#PFf?Dr,EBuWL+!1AqQa 0P@`?Ã7S8:P.tQJΤ1Հ!&]I"M൜|O\Y12j1܎o[$٠ BH\CvߍYP!yU,!6'^W\q&&bbqX ,TA)@4.kLe@ٸQ \B l4ڄ\XbWDf>M qՆ@I{ De,Hn{R"`)~@qڲ#iBlވ_⢨'W j`ft5EAy@d p3@佪ZKk,}p@I%r5#\r5Mj8Sf Ft(SĿED> kFQخFA%ړX\r4ׁ\r4L*. y><_gѽQ4d͢oXn z,5(ra;'گX_&*#$BJqi5EEq1``kdE4 BV }14&E.-Mw~="> 4DL%R( t"P$s YڢFLx# Q9b]G i4$ F]Z'Q}R@b"!X9X' {4/d)@t={oӺ?чf dac? ~ s73NcQ+Mvq̹F~`D &fgN><úWXh.cȞT{1vGUr\W*|?.y*ϵxcŹ\&5G5EdXJMA0c;7&})3vO~nW%zLDOvw%zoHd*5>N誦x P Ѵ&L}k4sܤMBj\=;W+8:TfHk:o’R&kޟz8Ș oIqk6G}Dڗ\`Y}Bbꔬi0:*^ܫ(ͻbL~ZйzTbp9M_- lY[Ia)GT }9)3P$yMns7֌MNip"KgjXӓ{$מ҈$ךmN5zx~ KU  T2 p9`vE+*LgMNȰ҅cegSΠDwH z<A8G9Ur~XjmiF[! t{\U6s~ua7%TbX!mR#HFM1@}1}٬}X|[u:kεZoyַ[u:kεZoyַ[u:k{εZoyַ[u:k{εZoy֚"_,!1AQ aq0@Pp`?} S qP巁-cDwq+zP/N]SH&Ovt:Go%IVz_V<@s/i2j互*`R略Sy4bA%h{iREJ}T!V"Ck ;0P露Nb:UXp$*NH@aQ@ Ņ?g8:3*C nUY5, $Z `ۨyhP;"*#ӝSRWk2nřA<$$ؙp TToQTTŽh7p&QӅf\M8`h(5fA&HLQŁP9UTEUUU19jNJ`(O?H J"#QT)U|-@J窆Lu=;$ BnN'7ԓ;\٭L?!HLYM.ofJ8MR,1s3K ."O]պlHE*9wZd:U\(SU.W=W $THҀޢt@_4BC(8Sd]\l81RQIuIO%9F"@l5X,1* PVT!G=:ψa`FוehwqN"( u=(f[ 7k弬p*jPbР8ZMV.JhOQ 5(NPح*fh3Eu)fʃnm"%cXZʋu$kCiSFƴ`Muz rN2u{]]M(CWnpE\e"[ztaul:3ZIQmʠ;Z1pnRÒGC.vpTI8J$˹; ͗墑Jq&tIcMi5 E43J҅tjML~ӈ;J ]bAZ]5 !bau2c^2e>E, CKvoC.vw0umv V 2b39=nDxX BrmWG]L]+ 9[hC60t1r8hEd6 BhXnYollC\P+JM45|8.6:#]CA&G Uf` aN\۪]7 3d^_S. PGNdOo\L72 L{ Rv&L3T&MѰ XN ..j&LV!Y@ TQL2eTiJ3S+dɽE[G^uL9҇M˂xӧę7Ҍ@n&6a@Uo2dɓs܀A(L2d$I kK7Rw4b1ZJ*TRJ*T3@Ji%]ÜAj~ Dy"; CyV@Pw*TRs#X%0`A  pRH@쓍}jRDi!RJ*T*R|W(qGoJ RUz2iq]ĩRJ"UZº04 txU*TM>ڔIF G胆-9]Vx*T>^))f`];% eQU] `4HV1%Pm]``ȨCӰ %`eP.)P91B,p!l6~/|S|:P_v/xNցJ5A_AX&ɼa7<VЄ ㄸH>TPMqZR.')UB(A"_3~L'%&9xӟ[_ &6g;,_Ρ7X>/=.? Z%KT@V@ @(AҠbqzJ*O) h9'!"j&$ @NQ25]RU@A+yR#~B @t%4bP^b@L`pdb)]$ A6KmZ+ iMۄ<( AJTUyhMP8á~(MHUP@ c B}#"z"Yv=ODYK)l-Yy_y7W4r~~u{?^(={- @ A^|VLb*K(dBDC)FͱԄb "דԕHQS7r0 L!ICRKs 4R!BiRa}p- !DOGH֙B?!yD0If',?߱޿Y^:SUy `M_)=xGx73840NAыz0QN&ܑ>[y_>#ҾNZ:wQ*j_V` ],J;N*LEg) qs\2!zwW好DV)6cЀ8cr,\W`høUuxS Qp3GK $[("Q J2낆G'$ .YOOly.,~*~`qAƝ/0gg鋽~8\ = 8zXo`Qt|ΙQaFcSCx~DJhedve/#fsЗҟG#;A(s߲#)_LQ*zG {84GqhL+17WCn8Z~p=wEEw|$x*?R ǥggZM0y uCWH+zy}3z ڸWjR݄ؑD}R91EF^X+Ӷ)PUs.(&Ozѐϒi}\<3SLYCx[tZ4}rK y&i'Jkw߰[+Kޓ80!x*PDMhwD7/q<> Gq+ Ϫ*qqR b>|r"ؐyq7eDׄ}VǞ'uo̲ơ<꽿Kz(JA }"|OԻF70q`YBF σX/-~I2kΏ@>S h16KϢ=w<q/VlyTj:庫+:q9l ˦צ3tqhFɠ0?Aa-6jPlTl&kGc6&ˤ N>X&FH.Mwc\Pk`,E[غVY X(9|"t)E/ y7Dk1a3U7O? 71z׍u[JVa61cG㳀%t+`*uQ x ^xUd[Fd.hԅlkz~Hv}C]ſUOC_6SRr'0~S]* =~pۀXT!7, @Y_ bX@s覹ˉ$B{DЮɠ&r͔+uv`A qۨ6 ]&~_ȿ3_r|5>l)nlJhĶ:9>jP2R~R 4VPW#Ji5b IB;JP/n7y7$ T2 ~TۀD"LĒ @c5r1>n4hѣF4?1hL^{=׋p :D*pGA!MWz ln?XXA s3A;MF#D)j^24-Gʳ"8\QڕUګ_oTK7#klA(pѕ.ArNUQM\f bж'L47X[R{T\Ov3';m15ȣC#6v`f#t8|DO `!M` [osr`R%ˬ0}bg7IuΌQ2M|fW0 H<%:sŏVpAT0*CSQ9z z @4ZW$ڜYb/G|KyX~<adܓ*+ۂkH@6 W!T:ߔmN\0]t]؈9/;pە\=vj9#E錤h C]#E:.sh ^iMҔbMz@p[$"uK6^ DijQG.YPlR](ET7ԧWްXճwЉqGdj!ZHT!MtzA/Cμ@ah.MCQ;^@픔0 j쨪vI RwZ3#W` :Ûw@8S{gkczDU .%X@eԎg+6HTm]쳿DzFp,XbU.Hx{Eruaqۀf<6V=jlư=MQ఩bQ:$]\ gRr;[7`QEtqF "R4ܜaeҜP@hQG M8vXS`D7 ʍ P0oxӉ$Du 6\Z&+ItݘҾ5ГmWAmwhy"e8Bl,aBPeaGDTI*Cm"H" }1$Zn7DV-CE@CfV^A P5s_ FWaCl;RdbykPAeU\3B)ݚkvD7f?C•0Q[/b+4%"Ρ5 |>hpY)9!7W;BDc؂4Q٢  6R"4 TΙ-&Ҁ-ߛMYKEm1QKC@ˈфЀbL^*ïJH Hz5-8"H[O<19Plj;e!d[j; B&H9pfYРy1VMzyۀ,ӄ&]?*͏c6>͏c663ұ&F`DW)a*p 6is?is0jL.`%vO2Lui@l~HÇ8pw2Tw/m^Uq/*H;!CB͗o  BY`R~;UJP5^]goKKz'[ H'"u⊳9^{/=exc G+Ǟey^{/==ey^{/=|\^{/=ey^~S㶞55[ND>6+L6tD-vSjm{ŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,R(<}ll(<L IS0P endstream endobj 65 0 obj <> stream x{toڤ)i҆"0kw8):Lͱ VL9.tXN=:@)Jũ֊mEBiKZo/ -M&`4 VykAw]':]q0vhKc.[aK6/4ĢˇѹmqEwX*'5o:'1ELڻ9fao=-\`w6yHn[77V0YHY%KZ]?3:R]rp^\{]N¨' .Ic%NShDwxmfxDu6hl Whd}OE7ϢR'=B+rƙi#w '=ŇOKoɠFmJ,ɟ2dwd"y#WM'(ei4͓~"ܐF&۩P$c? /qn~h#K l5v2o$Pz;hle~h'im's?gO΁)D3i 5 2#& *x{LTmЖ2v1%kfGHt*5ꃽ;-Dm/J9.o6iOV*>AOnVoohǒj=Lu>IX]e%_=|%ɯ[HISnxkFr=ʭgl-{oL'Edn37^e+KgxHƨ8rFS~WknXQcv ]d.hf3z_|M9NJT$y.Ưe3 >=_zd%/ꇎHԫK%HsۉR.h<%Rbz ""O5B 3뼃?qcѡt-#D>T#%Z{;"dž\Zmg?G 5eBERZu暖 79@} O:r…?KϢ(M5~jHZ$ޟ4Rw"IH '2Q+"vbT,cm>77G铝ٻwFFzzzZjLIq8v=)fꕘhZ,l3LDWZ;}>=-M;wG6];6Yiy9ᷬLԶg*\퓵7Yw253523S=jbgn5yj۩xVܾgh,e7P7MVۜiękr>edgg, Jzl|vBھՈwK4"ׇ "CW"Yޫ\EyRE[KiMbIzG^;=.zsa.kqEᨖ_ (mGeR>YAcp:{aŅC\9mVBdM||jwqՌ3Fp_,\My's?0;3riޫw~լVB$$[nɽam{#_ߤӬ PD?§ "C7GHH "A$"DHD "!D"B$DH "A$"DHD "!D"B$N#Ǒ;ժFF`"^,C"N*;h$*ayDÝ5DC(3@ QyxES0Û{9Û{@oDDEQRx3 b/WÛ{Fd oDDEQ\x3 b/(k" b/MjG-IjG/c{v$ {|vt(NHADwpT]:G!uEDôY֮ET X{qw}]?_TکhPOںD~ծ.b4/Q`գtT(SW nM; 熡&e`Z)N{j{I;$F0\Ґ'idd! +6a J8i:AHIY-"% tpTh9eAT ENWQŹ?xWQ%?QF/ (H^D|HN'^D?ao+" """""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""QH^DDHF ?|Q&?QF (HJ^DRH6;^DfHs^DfHo"@#%fQ\N5ze5RGK^Aa^4:&ʠ0dpICv榹NkCٝsNڈRh`NM)VJĬn endstream endobj 66 0 obj 3448 endobj 63 0 obj <> stream JFIFC     C   C" Kgb_4ncyQٝ(Cnu' /7/pðۂ\t/3W <<<<<<<<<<<<<<<<<<;"Z2%%Fl%E0&Q11r5/GOyķ]@9zCז'xH@^9*׌Lt@sB%11Ee=]iҖjgxC D}V6J;W;xiclMH`I@ˇZi\թg 2η+~/lmHi[FNtր["z@ik23PSRrL!2!:ʆ3_<9?ݢu7ãIrw_`H}_ɳs eA+`ryu,U$g^=brqGY|T$~v'xW;N8IMKrq+_Qๅ  Eo'QZ/hG^ɍꗇHhn~t Lt12/e/IJx.kGC&?_ɟk L5*g![+?IN-ya2ka&j$!ybd]̽ պ]jS}*3VBh۞yׇՓ].vզ+IiO#Q]%MJ7ּkGZ F}4y6};Cu'kVOr_iu<}:5'xK1KcȩJM9ur%i+M~WLsW 3[,sC۝}sK{ZR78Om+) ۝q##cW{SRvąWsU63 rsDsP{KNAOlQ{o>fr}M~}/u7MTS߹s tu]8+-g΀sD!8ze9V_D x4}:rrwW_'X/ޱk^z)w9:F:ή\i=qAϏkPq@v`3 hdR˯A5i۱vc9u9&<~8cν&u3} )H9$}VokD 6u9g45۵e6;kV劺iJ.J.J.J.J.Jii8e ]GJQu Qu UϜDE]nXJ.J.Jw TJh\ҋRRzJ-|_UE)QZiJn6whti_=>K~#Ly!DHϯ%z IGY>T7r(Rm4|#(v;`uo^"E-cx-SкV(v1;_YkFX=/bǏ"u:n|sĦ֩U@Kɹo Mn"Q9yGas v$Jn#(H[P ϳHKAa9nhH)"B #=<Yk0#C}9: >|l>AstϠQN}9:#C@P9:#C} _ /ed445 03612!"#EP7DF$m:IIN6)*Hm:$үi36fA$ȸ[IRde4bT_j31Ɯ~Zs+רtjAf3{3:+c:W6ܢeǐD3OA~OAÏrdKݱ+ymrbJ~zYUx ^;.k5.uȜ?*d3Mݔg/rB,B6 \NdnR$Ɏ^ddZ0Ǟ[)BLٳ k2L9$ķ9zD9,kŖIw֑#R&Ω*TnwiZgC~ 6ՉkVHݫ85@+LnN޿ZC,īP;]W~ƭkb1Vpk]'qZbMҮk@;eZ1,k!pkiw1 껎ZEDIrU ȅdԶĎbG1#H$s9ĎbDՑ'ØHQ<ĎbG1#HBYH$s&(71#H$s9\ĎbG1#[G1#H$ss9ĎbA(bG1#kp$yV^46ښSCjhmM 46TUiBikK*m46ښY\*NWaU_40\v ZlmM 46Ĩ ȓϛ22M v ׊V- nښU63ʘ ښSCjhc0UtBdUQw46e>Um #.:$t!b;Qv&d'#=Oxwk_Ӆ? [د?̫+ߚbcO8vpY. f&z+k$/ H)yUD@³Jc$Da۞Wn2NitT%©!^=e#$)Ҫ1G_s+JV^[QĈVRZ1$ȵt5HYo{R0 *j`ᰢD9tY=; nI6$n[U.,(4EeЪxJAFCScC FFID0ucp 8 5@-w1 Tje6b`}R8;غlר-ŔeN#krZ\ǝTH[To5Mm'p;4w #iHGp;4w #-ɷURfMUw #iHGp;4=SLHw #iHGp;4oEGp;4w #iHD,;0Gp;4gY_.݊q7X5UJ&Ή2t{DSNo%(qB= +I.ˑbQZh&@\ U*,R+-v*DhGV ą}% q@2R \q@+'][|A|AE5IwYYNӤ%6 SR-㪮qL[Jh25G"h";rn طl=ة}ٲp=Jn+yq/S,~(9s_q/%JuQ}l=ة}ٲ GBKLUhWlLu4?i2ςm$dxVH4&)"?c@S'K[?i1JpɛB ա7VZCuhn ա7Vйˢ^eY+VZCuhn ա1L%K`9lʗ7VZCuhn !k'bdl(ok7VZCuhn ա1(fHn2 ա7Vr|c)9 t1ӐNC9 t1ӐNC9 t1ӐNC |xi t1ӐNC9 t1ӐNC9 t81ӐNC9 t1ӐNC9 t"Zic!:rc!:rD-I =NC9 t1ӐŎ^sKJu\ {ׇʛ(cG,93y) -ǾhjY''DVW5W"#d\YdbGl6^`2&eSc*_Rɚ9̯NA|A~O\FyXnmilVG+/{4H|N)x{,m^E_ȍ SM=; dlZ;Rbnc/v0O C6Ί>-9Ga7 XG7^AyuאG^AyusƔ|T*(p# :# +kX!uΛipf04Fլa 5_zuiBu7(l5} feb53}b;ɭKxTlBO/7DT/n'"8[A#76m)i0thZEZBqY Z8)eHrZi)D7X</{UGջfdCf)eWy:y^??c{ܨpWK޾XCuwV:גcV)F(k"{ cPd7C (ًBp}LnOjН+?V ?V ?V ?V ?V ?V -wxM8V~:~:~:Tkrv;,[t,[t,[t'cOY-ҳnгnгnгnбJRպBպB7r@ Q!12 ARa"34#Bqb$0@P`?GGf-7,B͝o j,6ѢӺ ܄u҇,)Z>DMV0O0 VuY7lZ&\A6 +\sîE2B1e)5F +:7(8^(yX+hL݊=V4Hs4̘U)5OzNKgp{o28tw4TS։J{ýT,u[wG#UƊnQ \y ?-V*{j%ڿ` Hèt69QszjJ^Al# a[G>-|l# a[G>-|l# a[G>-|l# a[G>-|l# a[G>-|l# a[G>-|l# a[a)Mܲe>%>%>%>%xϨXu0VcYGIJ^ h8|K(Q,____Whp鹍X3qgՏjIJe>%|K|K|K|K|H>SCԦ`ʵ Ht1aa˵h4u/k 1+\H¿c/1w4'}&3AuhBtoG#ZDR-UQs& 6\*+EhsΫ3,~TM,mMZw- TbG1-ʦ2^=.0nhh d *sv^(s`{KnY룣x}Y_aNOU1T 4 kLdwL2k&;)ZӚֽK\g58:%Z_P24oiSۘu \+LrTN458 v t7\9zFtp˕+[m-k\E(V쮊b#d{9ߙDYi}mMq-/¤SXXV!^1iEwB)p Myݦ$;c w_*Fh̍HLc!Pdwj?F1oW - ѥtlѺڨ` GF=\K\ؘt"ƪ~6vatsX:0w O>qZ=@"Xƴ= cԪsKq*hU\D ˍH1SW9 kEI'$I}rO~uXvkeugNsSM i/tV]c9 ǭ[&mCikZΊL#"}=5sYg)G[Fdv659Y^P她뱏&3kd}Z'sƌicH^kiKFμH# zzqN=ͱd69-Z'6={W6g+aNoWZyۛAUFKyŭ" ^xn;٤ӯyÍ|`uB%_|v+DJ&^SWA!Aht/AETmig t<Wdt.[ K nWrk/GB-'q a4╲0Rs0ұ{Gzs[ -$ȣEF46آ< [>*wCMVVkzS`UTQ*b rr2VҁkfYk5fYfV\fYzk5cVk5fQk4 Yk4_ijYiƸ_Yh w}z0XƽM#VXdmb(p-gf@TOi:1V-O9Btm<k=k=k=k=XEG]twRy:[%0:kUiеCuVk=2np[t\;=f4K(VֳֳֳֳՊ \nYqkJzOˤzG ֪wDCy,n*Uݭp!Yˬ-V!ulWRfVֳֳ[}ڪq͹Li[lfŤ|}(\1u\ֳֳֳՑ]j]$;ֹ[,gc6+L3+YY urY=3!k[u Z\?TF(D^4)7>-93AϘA#5$e1༓a>T/)o)?yg|=/'~[afP>H+>Lng|}e/w$n9eg{i.\ʝ}21wY N&6H\%Ymc[C~j3+pmҭ#22p^IG7XSN~~([?UAߤWɟB~~>'0k"nrhg+} lo?[Vg+} #+g2-?-Tvm1Hƴq ʶj+[Vg+}f> ^T#&Hlr+}KLR1ָ/*őylo?[UT/lNZjDoևZsbxq'*){˩B?[QhV-*fMe [Vg*;p8F)UvGP?\]Ǩ'٭1oBwÒ^a)x1G_`Aά iG4%KDDʅkJ۵m⋴̠5o*ґe+}^;Kp>Ntoi[vxVa#Ozۜ2 t 暃ɭ} n%Ih f5P֧aƍǫ/Z狺LW繏S䗹y??sppa!:h,K+8d/f,iXHEKҜtrY֠ǒj#6(ƒFӚ)Mcgac:AZlBik}3u)薸TV! xfyC4e-,} heR D碱]B[LQy.?s ~KClfN~ˠ 9 & VLtYq7oZ-; T_+.|?ڟ䗹y??,->΂3G^Ž=kXs=y}MPڜXKcܰN}+}|2 U\Dts7ykTؠnn+OSӕF N/HڄlSpvli⹦Vv=}VыLӛ^ÚkUuA4}&i$ZE~H/j+^ҙa{Ⱥyj~K׍}aBMzTҗPCЃ/^w#L;UO >sif-*xV~ikuִZG?e1[s0>!J?$]I{uF#3uT}Tt|@>5Ri45©=&p! 'ls@ NYUKrit{V6G/+(ϳ!ؐkAjhۿ (V5TNmoӏϓr3o9f8խM*~J+?ix$ cYsHI'+LpRBAYML|Ժ'6V7Cz*dy4Gy-pņYA4`2Z&lJKh,c,ht(g"iKoFF X.U,lfd tphpB7њ02 ꪼیŮAJ*a.H+<홍[<3o [<3o [<p9؏2B&e:Gp \s[vx ަv<0|}Fs#2ଷ~]I{?6{Hhm ) S!-Ѡ*(qJ,5ˎ`p->rl#;T=ry?$$쟉mwAui4L-GtXiLG=oܻ(}?pbg|~\O?/r'~{G߹wP~ᝪ<wÒ^aOYy>a/[ x KV^BT-SO> T-SO> CC8` ZI* E 2M# q[7-V+d ?l¶OXcII{VkOTj P-@"y{16+ P-|BB޲/zx#/zj{֧6 OzQU-Grٷ-|ٷO`(ճo[6oBt,@&nU?'|9ɵڿm_Ķ[W-Kj%ڿm_Ķ[W/%~']qo7Kj%ڿm_Ķ[W)^4?פ))j2ڿm_Ķ[W-Kj%cGGح8 7#[W-Kj%ڿm_ĶVsǤ·Seڿm_Ĩdq ~ѦmZZZZZZZZZZZZZVK5)@%YYSX9;ZZZZZZZZR4s<:;:U3\aiN!-WWWWWWW'{$-ƀ/#@9HQOIj9ZjjjjjjjjK,L]ڭvɣs9g蛯-WWWWխ鯡zg l~[?yV~g?Ul~[?yYO~)ΆN'~g?Ul~[?yV~TqSH:~+Sl~[?yV~g?UOGG29Vl~[?yV~g?UMֵ?V~g?U>HyteǗlo}'=0@@KzUnŽj4 LOVz/wY$t;;oNU24Nfa nwNk4jo/O<]xn_,3CmiE;oOMSr>1PʌDc{ɋh y)dvt36D=[ӸVmU`8u{JBӅcG=y_l2-=*`s|-+zw :$0s?`&^vv&0 7[A=\RPp"|MB;PaBՓIͣ紭.a7.m~@$HsZ'&`~Jt9<`u fm9ceC0MԹ7Ys2(bǰ7c>WF+6KcCt;KMQu0m%S o_:\xmE1 7/H*뢜)k)9qDoC{G}7WD,k'rO~wi²wosLE @R _ks:65÷g4q߅pmm:8X٪h;@6Y{'8eBKZ[}pI}o%ԑ]k+w-5tx~"NJa/s4)A+]1c\;V ;ؘ?>I=f' &pt{boC+N! ÛVh9]2Zild.OxTٚNcja>Cg1spь H[g|̫17^-'Kgi'A#mύױ ANLR}*,z2M4\|9'?a ^熖TWLD:}=uNx/ڻ )8+cRdu]\kC5c"-u1%\-!/QtO/a` ֆ#}Lk8w&~hq88l}qP[pN{N'9,e޼(#c,s@o1EqNdf3xִ(1ݻG `K2FA^r;Ϟy,ϐ3,]sO1sUǖW}ݸ޴MEdRm-[vTƨFGqqp_gƒ 쁌V6D&umEj?#o,|C0Hp0[FeH?:'* NP0ȑh(Iu5w_|8q<<GS<%Y524(C,Y dכ&X?Sxtä&7I:Moxtä&7I:Moxtä&7I:Moxtä&7I:Moxtä&7I:Moxtä&7I:Moxtä H\# g #48#adp!bx3KwyS?fe@`?g<&xl3KwWVEC3-gO#<6xl3J:w1$#R `bEb.c00&pV*RЕ P*' օ`k@) d 0 3 ?!*Uc1s E! 9">:@(0Da6 P̃0 LElBTb~nF'akDTf@ wB~v#= K\$ɤ:* ȗymPՀW+$l3J!$;zdb7.3Bb<$MsYm"֨.3K>JJ5Qףe S@0>*O?H#"%P+L*pPBp`8eA`!$WdR/:bǡ G$c/QJ@,j l11& ы4'_0@ACs-0 4>2j?Z@M10~B^ .ejJi} 6 ѝ?: fgo0\0f>#f,r}7Qv >Puq.P/υX3)C bD %N Mc;(zUP%NK;+Ҩp=A/"Br.Uh9eD/"p,f05Rqz r.hlD]SPWBaFE]w!ST9QIsq ‰faBq HCRP_kH`s',`p6(NhIT@!dZKWEf,CɐGN?Vwθ@ i9 caic5Ƹ S42K4(fCQhqLhBN4MX4Qrcϫlgx@ u^Cү X< $-i>p) L_hH`laAB?hQR\JBPNXr5  BdA*Aʊ1(ҶCTxrLH5Qs V,ښDž..0[( *gd !B 'gXWҀ$G5HMm PF*RMm'e(T|Ag4 ~ &hfhfhfhfhf@QMhcJk43C40@D43C40hfhfhe' ١G #%39"<<<<<<<<<<<(@6/h]4(HiJj@Bpwg92KO(;O(;O(;O(;CɅPo.4e B(;E(l2ЂHK0CiJ<<<<<uT4(fC@*sUP3ъ!hH7/5aBx+D:5 H&(;O(;O(;DT/nh[*P/<<<X| OT֋(:5 H&(;O(;Cr'ƃ B3J`T""6*Ha8̪ c*  ´0G L?@Av}?u7_Tu^k#{Id?$ٷ,4 ~Bʘ49DAvU̍gB@ NfW" gyjzߤtlCrOom,FrL=&6IzMl`=&6HDw̉94 )zC3Z?zMl`a'yM ,n.p(=&6IzJIJ7%͗M<4v VF|TM 6IzC(8C(T=&6Hܧ@/)h0\_=!µ/um7=p~ޥoGˤIAC$uA/pЋ]2 W4 pM8 ˧ypPBs   p']{LJ[ {|{2̥ X8hl~aE@C]y6>P*DHNEX]= &HLsͱlm#"rm]m]m]m]m]m]m]r ~B*V̙vWivWivWivWh~ (&m]m]m]m].I4NڻMڻMڻMڻMs7@JVWivWivWhq ks}̨I8 @Uq:Aq\MԺ~ԬXh F04JZu:t)z -!TƉ( gR mQ8g!!ȟEQN"cg^,'*{s}VB%nOd4T[r#P@QQP01jߠCPn+*g@Q2^Hdƾzs\9LߢU!ck篙1!x|nF%V6cnÁAt@+ Lbs' <(vFH y绡3qN#>gHXk\ٞ{yihp`Chc`Z М6\CB`X͖X0 .ȕHp{W5  B (Jǜ : b1A@̚|4`""A!1Pר(HGK5I6!ES vZPڲm}-)W048pqd&ʡ`=ù}膰X c C^0rxmsJ`@!G"Zf7A?T!X/a BZ ^&nkyZ1@Xl?spσ$b5b%ଯ6`al]N"_)AaP!$YNsj˃tM A U~Kܧϡz&>88n{U^o Ob^>>}c7ǶsT ɐ&7I:Moy8Lfb HAzkY7!8}}ʊ.Iu B'O8qͧO6m 7YY +HOG } K. g8˙k}ZmE3j-Uڹ !`I&%^jg(K Vp2m}00(s0D"U/5ESn" x 5$D:EBQxnw0]h! -ܢƠ_V%(8(~мBDh8Yh W+? 01 R#5Y h(R@.' @Pq2$`jK 8&IA~>6XZ$ (1jJ](%Faa+J`Sm}*y'0LHHdX!` HT 5K* vc"aM >| L9j4)rP@A& l\7*\&RbAhQr$!T1' !uP9 f!Q8\lb@FlF&n` 0] .$~< 꼇 {8IØFbxIAxX2Tڴ}{i ^ *5~{ˡ(P⏀jL80Rּ0  > 10;r鼫 b3%Of]VizA( n9#6i{[V43Z5XD6bm|ڠ?&Gx4Z]uwM@sTS.nҮ|8h}p@΍Zj䡲٨d_BiWh:oXYTd I<_BŘN!EJv|CJq[,ߐ뺻P㘇WB贻U!jv׋H\6Pm ov\Y6ayWKf_s8FHM1c|59h3N[I{-jg_R* HP2',7k8ҕ "͖Jl<\b:嬇]uqWqSvUfƑNԂ$1p@@c?xL/*(@S0\-z}ԀJ)៙IJ/aghtԹ)w]ط:T;>o/{}+'Oy>c|*o%8\rqL6IRT%1R!SSSWtW 4pWpR\1?®뺵!x m:ƣG5$TB`+B)m]N5Gĉ:Wux0ST w#r!iz?ifrC$ΕD#vmO;FIG>!@|$u}*p K HB 6KBU D\1!6ՠ%ci_*!1aAQq @P`?xkO;9{@4 k#yLwCBd9%ȚNE(S ?&;AN00gބLS[jo8}T+ P}@=xdG>%EYcb-çMp0aq@W#x< )D8Sف7z /P2 C7}(_9JfN281n\,JY]e- Gf[mQeY^"բM.jۋ=:[Lr .YqiM;\%՛ aKqM\o(5qS1 V90)6L߼?|)| w4Z?5 )J_kY)L"LL*J¬? >/{jI2oTQM&H9 'CڰK3bWA.&c<Ĕ(.#(j#} o3 2Ĥ@(NštRf+W;d>#8`PMh)LhQ5]Wm* [_rxF=sQ19wʠЏCk#6KpZ sc8N<*b&:kX$i *lw'm<3JkIQJUSm6YM]}CL%EjRbl9 4$sX>qѴ[07`|@i + T 0hz:5?wb?SV"f@6iii}fi)A1|sM4Mn>oyoxG8:{7LO*!1AQaq 0ѱP@?Ce \xRVf ɍg!n^{׺ 6t+ w޺Fsl$Tz9w&P 2)Z՛o藥]HDwh =y8P+-V) Ui)(K\ Pd7E)QF +LTbS+ӔHq]@>5֘oWDS4EⶨdA*bihEԽ5vj s?~gr嚭9z|E땾y9| + 42RYBq|=qI gEs7%fKt 4/ g<֊:KyǵrzmW(gcUDAAc^r~tiH]Q*[8EXT(89Rds\_3/k5[|Yt:ac!b<>-FwQ@$uoS؅4ZD'PfhMU*@ j+yWm@81W\1 r6x tfʹD ,@27fYre/" k'%7,mWJXue(n iyhi ) 8W/b"(4u&ZmjuzTmukq{!Uj%3ՠ^yi-XXr֭?fhf%xb$ \30DBUyKX_1YՓrl &rW6. oSF)pF9!-PW`k fœ}_VÚ#ff+]9¶Taf5 7 )]35&0š`B@H)24Rfv?\r+dXQCsN Y.|)օM5Bspf.RjZe,Zu'*WgeßȆ 1Mm{GVaҙaau:[\rFmU4ypFZI1ڨt9 !9#[vs !ћuދv*`_l+ǁ\FVw2 曱0*(VhXuN5kuG( MzƶaWEÙ{d讶vcV@(h{AB񓆴ܷ!>)kʼI9")"F#@2"TPhGNLӑ|GVԮq2RR$1"< Q+رX-j3;<;<;8=`ykygX.gvy`tu'vyi;<;ASyg5<;<2ygvyحO;<2ZNf2V2N"߅Fҷ_8pÇ8pP5BPXC )u &wXj gvt5o8p u^"idJjx 8YMZD C8%kax8R$u_(+ɭ* 5j)K \, (Ja0Kʫ;3 /Pa$ SZ8pX֘bI1Kឝ1puUb`8En55/^u^8t-[jJ.fTULj k*%^魰SVw@Yʗ a4ӓSdo?ٻ_ ;vo 9cNAv>Ka˳etGؾ;[@ Ȱ3KKbED+d.B2j 6˜[rOLP@7}codo?ٻ_ ;vo '?N:cg2|q[`i K'Xbŋ,Xk4eB֓Bφ"*@ ,F@2ŋ[N/7–xDw EKja/Ж S bŋ EyePBcmboi(%r,p5?F,Xd®̅0[Y,U Š^#΋g̺, REE@a6Of\Uq}UDn;MZDZ+@yrF'~PZ$ zЈ,̼֗]|FiNT W-P_\Y[`}[Db!8C9=59-n=4m@LkE%LϽyE/GlQ>Au18GES@Wu!mI|?xO0i S3*i Gن/!t_3:~e- B')A_! gePվw>t j,GQ/Y-9E:$Y?qzjWyt#S461jS 8`[ZCt~dC}cX*qlRfͦ//eVc8hOԠ}1p쭘 ]1]ns ~K؈عl~F829柂i5ӁueU+y u /D') ?ȝ)]=rC%5>XM'He+F[̈́bu?fk&̤!>eրmA9WWw/=InORe|q5n66UH("Dxxxxxxxxxxxxx0a]AX(ŃWExxxxxxxx,]H(OFQ">%i1UgX ########!TS5-K;5ud1 u @<Vs2bXVF曂 )BKȚrp J6ƈKU95hh'$sܹLrJ̥礮қF/ T]PYG@bk ׍'#zBqn;_I@=7CWeoxu3G&т!@bA8tU-f:Vq8USK:=EC88qEmihϧپ\HA!7ϒ9njgA}Oio}]/AKR'9.AgYf"R 5o~X n,-2FZ \_rv 9|c}hz۟#"X(J.ŲUی' 1h/IQZ^M h'hzӟN;'} ݹ'hzӟN;'} ݹ!pˑl(PB ǀDU(:@1; N2`q$M5<<<<<<.U6 Q"\ɳ}; v/_'a|A u]U`z\_ Ӻl]า]c~'rN;w/_~ajW[]6wnD1[2o+wq:@._W9qD7kٟ3>b\C}p}Vc(7 K&PVa bK=h09ЍZ\;KyE]#i;eftEERwGJ3Es>4.عU O&J%>͜ow]a]λ6j8a[9*Җt$r- 5fR/$XtJ[1BzJLG!ub,A*}kX!~`4U(4rIkn4ʭ& sz9xpȎư׊ b` F Entf@m·pٮ8vN" 볹aA@(@ Ex5zqJUH! lfyA0:[a`tt㗴^9M +JEd`D> stream x{\o0@(`ݓwi#/Ẓ2'[4O-SxEHE1vS6o=}83_؏1b5e6t_Z&K[|Pc/ImX/mA۶X?qy&CIYZo3VS,یew\~qqq%o[X-Xϝbp,/5 FK`*3 b2L7O<潃dԣs^]v}=m?+QNڎܻ|xۅ[^~֚?z۔7ZQoriߌ,?mVbPaM>52Z[Rt;%sɹUIĸKZd/iї3bP?uzS~ yȊC_6Y_~OX_}x|7Sû ߙ2dN\T={n6ݜ6;C_]; >Gwl-M\wlu'bг\\d7[cBevG۵ʊ+*wJ溏0a.3;k,tKLW-lp[?yrV}:Q,hn t \FSvkBNͮ 펴mg-<[\S|.nEVkU{>2csÄvXilt,e+Pٮ{zzBYoaek6] J X"[QiD/s1s:ƢTM=vBPvqH%MEV4qvnxZno=б,rz֮xNE<'{|h'us<0i\nN]Jg5Ztkzš]iG\j1Š 7K^n/ kl4IK+ʜ6ngMsfܕʪ߸+ݥVg>&z"3>Yp˜:&9gO3~d˒O{*+?n}ܷ'97?.Į]uD>y'vzdR@0?kE5SZȸyt{|AJWOnKbHK߂yܳA &]sT[zn͢* g9n{*B9dڋ8ä!wюt5xz@?@kT3k ;XͶ+n-7{!cZ.wq?tuVh=ugzzRqzO^X<HOw\V7rmz>†XbC yP=!|mI6CQ>/]iع6u~7#OH\Z,bZ58Nhx!:"S-op*N3A.l{C&t%i zծrJ98"8Xu׏v[L|Y@񶸪M zK[!ߪxaU[ov/8o5F_wa~_՞5{.WYjc&ލMnez5*w2x#e mď_4ٵ-; j67Q鐮}SxghhChoj'B5Zsx |\v!y#TS'۝V=HZh.#CQvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]hGхvt]vrOR)n.G'D }vZ=H]c߮I#4|J=H?cβ9@@rv,?4K%i P)czrd8cOC j;ıc_,3Jvbt תrRIǘ`{cWGVW@9`OM)h9Mx/i2|gY-s0)SLAc+ K~¶ +{lIۜWv%/jX]swsQ-ǭ3{r4x'ڭx|:VhDQ[>BZv_im Vy̬.dLkqs{rŷn'Rh7〴}QYҹD)-tՍ P 6] M}G;"|ҕ/{$ v#q$߾> stream JFIFC     C   W"  g\)o>kZ]h"_f}tuDy>/ΑDìY:;<6.\Zg^^{:v|~&{ y:3]N?Hu"ԈGR!Hu"ԈGR!Hu"ԈGR!Hu"ԈGR!H7j_/bV87'QP-LXufw_R#̏@q^;E OE2)=D%+ nR >FSfLՑy9#U <}=1dZIB -^ۯNPdS;*d:6:=29)Sn|G%:ybN_Qc9,a,a,a,a6E"U7ύXlrX%2X%2X%2X%2tfaupzUƒ렸%rc{ۅ̟BpU :[iht̻'UW|K\Dٽ=Po> ϼ>FntF@g702to%F;I0$N :0$N :0$N :0$N :0$"j/îN :0$5a鶍=OylanyIJ9ם1ˈ>ރ[zymA巩[y9!`G8=Zk_rz)_|7?he ?a鶍=Oyla@>=M6QmybQp 4&"򈾏:qv$,QycghGdQOD~AְntF6X ~k]Xy\4&-P/|ß 쵾_ m}]dޚ8.n5''w}Gk 6Mk9}s_1@7[J02ۆ2l5 ( Y7ui3:v#RXޙnyb-,T}˛Nn癁v_ԗ3۝7*ĮNkp?3mYƷp5ˣl5 Np^I׾7 Fthq |BAp3psLk6Mcʱ+?>̀>}ϓie;遞A 5.k[!ll#{V5ǥ84v;JoKiME ]}GS753۝5*Į]͢`sg0Fsg0Fsg0Fsg0Fsg0Fsg0Fs\(o`l1YZA$yr0RW0Lg0FsgS⾦t]UKaǜ`I'z I'z I'+%+R¤bQICW-2OD =$@OD =$@sx(7wZUL0ߑfYFF/,#K{Q7[cm/$ DZ{eUjBժRfǽTry\Hx*^UZPjw+b+b+b+b+b+b+b+b+b+b+b+zھ5x{)Q짍G5xz2ňňňňňňňƪi@204135@ 26"P!$7#1ic,f.bQnh"Y&1t4iG!J4i^aIq hL"A x1Ia 8IO╼|KY?Ъ0ȹK~jw J.Y;P\ʦpN`܉.]Ծ:#rKBcl R V)Jޡh׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׌}x׃&ȕ)pzhJ3MDţkZ6j\6i\6h^6g^#?ШJqwL޶e*L \4ds45GϤ?\ E/he jԋMT5, ] ERRJT-*IU|ۤ?js&r)QLRiV]9.;S]*s{2&y'>!u~Q.tvCLZʭriJdkRAϪC}1}SN:E U'3eWTsꯐ")ڝ{>f36ͬFkjXf36Ew+cQ!Yv]jڡv]jڡv]jڡv]jڡv]jڡv]jڡv]jڠN fS+BPT. BPT. BPT. BPT. BPT.. 醟 W6oW 1SH}J/'Q~E/TENA, 5<_R4F} BO(,ɚ,d 0D̜IKDÈl=3Gx![@+&cBJtar{Z]z}d*P㥣uJՈ(F**B(^ӗ.Y( h"4rX$O6P 8);Z]zǸd΃&t3ɝL2gA: d΃&t3ɝL2gA: d΃&t3ɝL2gA: d΃&t3ɝL2gA: d΃&t3ɝL2gA: d΁RU^L2gA: d΃&t38Hh7teL\;cF=yvfnK,LB"R6Բ Բ6mXXXXSIZqhcNcsӘƜ41199`as> $ )zYV\?]W^D֞l9aL1Vg:0- _ Ҥɨ_J `ILy1<%(uS6949 Hm2z}4jj)bThѻs<\YS+W£鴠\L TٵjFj&&$V_we Rj兺*hϷw?h$qnMGiA{<7~'"uGԠm6=t%K!'/,K^b|Rʐ]LzVG>)_ ]-$zyiύE.3>T9QM /asꯏҕAfߗwh UT.>U+zG/sN:N}UR(?b0NT*ddN&HD$^Rr״U|~UІɬfMc2kX̚d3&5ɬfMc2ksGb9Wcapˆ\2 e.pˆ\2 e.pˆ\2 e.pˆ\2 e.pˆ\2 e.pˆ\2 e.pˆ\2c> !QS14q23@A 0a"r#BP`?(rdr}t%kY^rDhUЊN-2<%5FR/X _9?ze8)'RºNvv`LF6P~*mmεBݍľ4bJ\QXDQ1WQIRxQ&F~iR)K`\S#̣ }ɐnt䄐]Gl,\Y . (B˂!eeಈYpYD,,\Q . (|<2(": B13b˂!eeಈYpYD,,\Q . (B˂  $S)m!}+=ENx(*Sf2Yϣ %TBܟDt:3I\Zѹ֍n`s-hkF Z70Zѹ֍n`sHĻ"qs-S*Hsxs-hkF Z70Zѹ֍n`sJD;LS}wޑBr)Q0e^d9J/-rV=,y /!+#(m#:+J_> ~o)hHG;u9V ~q@>A5 gQ~DW^>ĽH(}#:8*mR*=,3sd!,Es)`/' I0<7b]4wwTFxԖh Q1Ʃev V4hV<7b]4wwp { Hծ$$$W_8)hH[|%Z+aQ;~ RFꊢ*jB *!ifɤȱ 9Jѵ?~b֊I:`x57;qΠqp/e)h,~gXYiE`*+QX TVE`*+QX <4֢]EàEؒwEwE`E`*+CC8+Rj%F8eeìld I!Grk#d5ܲY dw,;CY!Grk#d5ܲYnĴH9I-T dw,;CY!Grk#d5ܲY dw,A (I'RÎFRIH/Q!123 0"@AaqBPR`?lW*rL:=h7W^TrA5LRu,r}ڏN-OTl gBمe}GiZfo?m+kDbS]ߓ"2uQ%yTޓ&7ɿ&M2oɓ~Ldߓ&7z91+7ɿ&M2oɓ~Ldߓ&7D^]ĕCYڞߠP9K_{Y|pxtAx9o x[ǂ<ාx-o x[ǂ<HXވD=rsB<ාx-o x[ǂ<Ƴ45}9x)2tw)6P)6P㕽oQR9RxƆ}XQzOuWT) _DosPfs)TC5ND}jF/FW:J GH*W^%"UJIxTƆzUJܤ] o8qyވnquz:&j,QU6aBjxZOz&TCip#lFsQE,ے͹,ے͹,ے͹,ے͹,ے͹,ے͹,ے͹-Z7N4yfܖmfܖmfܖmfܖmf܍1=DLL 4!13"AQqrs #02@aBR$5PCtbcd?THGdxKѯ$e#H~#5pQ)3ed!r4+ek0EͶڙ L.֐fɜŦUi2sdafIO8&6j"ޞqmfYH]3H2ܐJv&Z)g;ඊCIٳW m{3E@E^4\*`Y$e22,!'<%YbuM:ƃcANXtӬh:i44uM:ƃcANXtӬh:i44uM:ƃcANXtӬh:i44uM:ƃcANXtӬh:i44uM:ƃcANXtӬh:i44uM:ƃcANXtӬh:i44uM:ƃ`p/LCHRRkӍFM͜$*Wu:JP]+BwSTu NR*Wu:JP]+BwSTu NR*Wu:JP]+@q+Z%#IdU 6`ZS%!:dg7XŪPdhlvxZvw ̥+wH9Eb#dl(}gK TT6Qq%R4%M?6?6$$&[<^CH~.6ZNYs'5Af];$Fdp,29-FJ2GM R}' fKQ96yL*Yyf?U^3BDoVO \R wVT)STpU8*N STpU8*N STpU8*N STejt%/2$)pU8*N STpU8*N STpU8*N1diCD]c .b%9^!;M/p)zO / dk]"0&P Z%'BIW\\<+)/o"еLxqq+dV0ڈҝ$N}kKoY'֦$L&o3R[D,`֔8ܔi\LBx,pB9Qc.=<(W.Iۃш3D2f5=9vkcp 0(M4Mosgi}$|#m  6.f v]xڲuo{bcUe6<=Gv;O [+ kZpV+\ kZpV+\ kZpV+\ kZpV+\ kZpV+\Ɵ.0%xcZpV+\ >g+A<\,9Jx23?0O <]CH,+q8X#Wyt[+K6^sJ+Y%`2JR~Q8^{pMlZ4R%LDYLExBI gngngngngngngngn(IJMJa'CqHC FBȳb[u4DK3R4|&T|ն"~Z@޲69MVJyơ$mJ.C2m yjXK?oygB!LGS#) d|Fm #Dӏt|s d|ZZA!;\8) )%̶^ʝi+;2>B!m4N^._ FȜbLkѐ|)%mXvLy[rUjd[j}dr?`ee232^G8!y$vyY߬j}byC-qХ̌CJJJJJJJJJJJJJJJJJJJM |+}$Sd)YR͐g!J6Bl+< Vyd)YR͐g!J6Bl+< Vyd)YR͐g!J6Bl+< VyK3n_n_h}>.BUƖ*c'hKm4k-B#A(?ӏpcͬ"g!J6Bl+< Vyd)YR͐g!J6Bl+< Vyd)YR͐C)VTn9S, DqKyFIE$DAY5c/ao?F(#Cq qKIˋ"J&Ɯd| t&R cj5lؾ6)q.21J&Gt“2TS-=}K+T/~L21ǑMiR:J"i&yfBVnAK~*]T CDC&);I#Q%BΤlk6PbRǃ$~D5rQ0,#R8ҙĚ)C$L$D{DxMیB1i],n2JK(&OҐQlDyC^4ƃ~*]T b9aزZ8~ڗ) V:J̔IIfQU[4YyLAD66NIz&y ۇƥ!H$LV=儌Feediϣ1XYX)ZaXf ͖9,8;$șm =?Po.*}.JՒ9{FWFWFWFWFWFWFWFWFWFWFWD2!k49h{KDI^R—gp;/Y)zKw ^R—gp;/Y)zKw ^R—gp;/Y)zKw ^R—gp;/Y)zKw ^R—gp;/Y)zKw ^R—gp;/Y)zKw ^R—gpI)O*!1AQaq 0@P?!OdFP)=(O98r"1ገ`tC;9Y&glRiI6x"F0$DᾋvC%4c8b@TŽc_ jvmP"1Hh/6cgG!p$}DLA'Sn,td LD=0xqqqqqqqqqqqqq1C>a3 h>dN$A LbaN<5|+BK %.z;8B)$ȡ05'W)6pn3%Z`Dq;qXr@4݁&\B v `̸Ccbqw@0/ᘃf0$ 9X$:)C0!d plPENaȸ@ CzxcӮԌdm&9%fn=` 8:PEbQi`g<̲DJYLL@òo:9^=?ÙXt!rȆr ,PzbC(a01@(B"d$Bh&+ ˓3,?"ɺu{ĐΘu{bX8g?cyzĞ"r PjPBܟ:tӧN:tӧN:tӧN:tAAH ӯN:tӧN:tӧN7d <O\C%`e.A- "(L fDA,O rf.qeqnqEG=acK]͘, ;^P:^bQS&b\*BICH|qH-"E_b!03 9MAWzޮw]^r >,Ð** * )pOr3H漮{缧B$6Pr KAsW=v|gՕό4&f|pذExHٸ4eN&r3L ,6{999999992f /!8@9O q$`!2bi,N_y ӖՕN B< Bd>'i92ְ G| Ld% cD#ZFˎ_}*^!21BB yL.a>BVou>`Zagidj-AؓO>5 nthyd( cwe]s((;zeVV>C/ڶꚤK_] `J&c4t01Nd89Tl}51SAĚvEv]ev]evQ `pDx D^$ &M"<4Tl} lD\?Z)JR`dN8e(G /SDH8]/ t.^KxE< X@pgHg}5}\Ȯb‰h$Kj0'2YCd_ FJ?U7:*^N5\AxS8Dq&27wBbLtB5;/kA~nt%LTj&}t̕/Qt]a'y-ΈU4g_E3  @qaa o%rN$'I% WӧN:tQb`)@L6@L΋a>uJYNAy@a܃AIqbS"&8 Vl+a[ V¶l+a[ V¶l+a[ V¶l+a[ AEQ bQ,q $GUl+a[ V¶l+a[ V¶l+a[IC!ID`$ưU.ʥT*eR]KvU.ʥT*eR]KvU.ʥT*eR]KvDw03W0e8q;3fx,]\ǒ#PT*eR]KvU.ʥT*eR]KvU.ʥq 0nTq"S&3&@F<@Lc'" )EQgl -M s P0A)_0qd,K|왧JlR8" _njTlFD&~i@.:Ȧ'hHO]> 6,Hp &Q#ap@lp21pbdOWyB] 4U"XK)PgAř%ޡȦwk||8<<<<$48ۋ 0^""""#TDDDD.>Szʏz=aL7t@&oX!fY[>@FrD731)z;KyϑNNzp Jڵ{v^ݫWjڵ{v^ݫWjڵ{v^ݫWjڥ ddKr ᑲp^ݫWjڵ{v^ݫWjڵ{v^ݪ_#BHrO3J^:'EƩ\ OqIJ\P 3]a ',x7>Fl>ȞX b.d,s6lVЭ>#?KE/{<"8қKqLOQł -ˉ1rDQ`^oZg\3,XLIPl ! &ͰҲV[AʧT^""xY*CCC.Yz#BA1xx6U}|4+aj5F)$TC5ZN O ~8H )>GЩo_LMiZk5ֿZk5ֿZk5ֿZ JQA ]RV1>Tx~UpR'{PAPE(tk_ѭFuRA%O.NV_o28U?+!1a 0AQq@P`?b1ZS5B4׷UT1F\;/e?=N_0>4yByJ1US23>!ʔ݆3y3,2̳,2̳,`F^@efYefYe rbiF+G.e*b8_csߎ\hW\HR=mm':6mCF׊qb839#csoɽ+cho5*OUc&З*+otHhRF-}^I9d)7@s[ Xthn\ֱVH%*Vc䉕4Gk3^9>83%Lm(TaF0Fks1.d+j7l+O7SFk}bF$bCg7.Xdž~":Iˑ"ЗIfB6i/ĹLrQ̓$2L$2L$2LT.d&Id&IdLoHc*!1AQa @q0P?1^`j=KӃYw<S+03T8Ih5ޒB&"R*s@9.lH +hS(N8 E@$fꭋa VHKp@g7 1LFR^/JB cfK`hA1|\mMM aR1k:2)FiU9tȨ@Yq6}לfȀ9R|՘9G)w<҃OÊH,6.B6028 !${> 2t1qqqqqqqqqqqqq%YI,E\l]W?(iADet!D#)(:!!xDW,ڹ7QjS 'l* z9$XyBQQ)"n4A  EsR:)6A#:̍5r%%XH("I{Pb$!&uP9=)f T2Zj7\=1!+ $9[9=*d,F%s*8b#LVosgMDA  f"ĉozZ&L4`D螣O Sf"ܹA!\Bm(/ gk`\j=a"ڜ^ ( 5 B8`myT)+"B1(HFks*G;].zAt"5Pg؃ H'CKM\d'MH]"*3@[IppP qI*:ޚ/ "æz4>'"s}UP$X},=JL$G8(f)cFji \L񤴽/XCu}Lhp@s m\jW0ڹ6as m\jW0ڹ6as m\jW0ڹ6as m\jW0ڹ6as m\jW0ڹ6as ,FM\Am\jW0ڹ6a+Bg)9pSRX15r!0D2O^Kawa#XXA;u,z/ .M&LF/rEzD"6 d._ȏ &$x-\cjWڸ61qmQ ^Au+ 83-s~ڿW?j_=>;}X 0Ii 6Rcg\@r4?uGb1k/CΌB#$&غcrI#ҔFSdORE$I hc mމAZ2#Z, ;Y޺wu]gzDl7G+ZA{ωx#EPعMs C@G<+C&NPK<`hT~~<^F#徚78HXw2*TdJ@bNp{ƁLW܅̡Npː S+cb֢,Q% *s Mlf֢A 2P !YkBO'./C#De\Ш+#bmJC4Hň%f ?A1Œ%Q]jWߎ_._&%5.K6$)e4p8"QXIM 52-DVL|z}Q` p/h"}RBM]U.UKRuTQbϔlIةg K!!eqpĄ.R4 $ьtteyt 4!JR)JN102n񔙌8H$E*Qq><^ ,W_g]~u?UTH@jc0>2G()QD/"Գ@OY*#[KAo&r@6LR*u;#|c "؉W8@w!&\f-@unpfd=uspK`{xp:G`Q'u9_j3'1 @t>L=k@<H!c&0!>C̀e?Q*d$bPA OѨ(Fɇa2UYWW E&"7)G\w8pÇs ؞CӚ̅n‰Ax(rNi/yʂAkկO `Mk`30$l-,G?G~Eڿ_įW+J%ށ,AxTv#0377à+ڊ ˁ_S6S"fzp{ G g{/{#O5my+,Qt~jak8晰c=E]bZo~,}]Fq^=!U!~ϟ>|ϟ>|ϟ>|ύ) 46q`KN46S>|ϟ>|ϟ>*k ,9t)ܑ Y>1B[ȐN\z%޹.wKr]\z%޹.wKr]\z%޹.wKr]\z%޹.$PIM$3@^0\z%޹.wKr]\z%޹.wKr]\zөKGDIE *⯊ATfjަ @ @ @A!!>${AVN|" w1*eH. GZ'F @ @ J / -ĉ)sD 53{T[A2Sl 2L 9uC+i05XìBwJp[ G MdAL|OXEY2=l9ÌN(8Yڡ/ HJ,b)#dR;`!MAQ2)d,j}`W3+5!ϜT04/;aWadQy.IŸC ͕FI`)ʓ |nj6%ƆPB7  08Wxp#WM>s )bI"fxM5B̭%2qtR!bF4> stream xyXTEҫj"&]wf̥\WL-fT&j  "(&2L30s:y 3G""""""3_gZϛ=(7W~'OZ4_ЧDw9KjG+]&_lЋ=7fẏ_H8V6z./i4Ə|)0Xu,+1BgeUa,k=r]rʤrߌt~̊-r ✲ eEҷiYzEo;:mD!~;/}/N9D?i,(2u7^=V.~ڪ* ߖ]eJv^7çNuח/>s9BŌyG/ܑ#2.~;n+zvi i]ۧz{)Q]\|FYBH%gI 'Ms{5s;t֘4ȡ['z'{_; 3ݚ?3:qҝVne·Yu;ɣˎv֬m_]wV+R;%n<'0Q :ZWSG\vGjQm&xqΪg5ܒ޳mxv;xonǚȝ{ڝ`I}}6p%kּˠf/>0YE5R[gZ8'ɵ˘fdT+չ*NI=,1?Wz*)3g(=Y$/S,(Ǥ]P"5}ہ`;\lp.vb;\lp.vb;\lp.vb;\lp.vL;^Pd 7/LNMORqH[I:!'(=9T'Ӯڨn~_ឡj|̉@JWS~rh9(32|uȻ*Ja15LW\jD!,SS]=궯 -݈v_)S056%7$o?N6*#OAܭW[rب뀇qJR3)C[k>n2o{5*)Jm,tY^,g^=8`otVLlæt{j,X'L+Wobl:}dvVN R2xbg?\ئiL-vJF"s9\7'ӴݭJEp˴ՖJOEhyմ%w"K_YfrNfPdvb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vb;\lp.vl,as]S%L]nTd&M%tRz*Dvcljg;&ٴ]nsQBrMp޴Qz0&L:[ndT:vg;sdzrg+ډgȦƄftQ(=TR. 6IJg.ʕ#""""""""+2x endstream endobj 70 0 obj 3304 endobj 61 0 obj <> stream JFIFC     C   f"  mOiS5\ \Gimݵ>H^;C|H|i0 Vg{jZkM2uŰ1.omgjQ_,:ƚN'MMMMMMMMMMMM#E)~q;\Oҝ./NW'!t#$#$#$#$#$#$#.^u fV):3{ހݾo;D׀kvZݐ+cQ.Ȓw)pz_£c!MFf f}|p}iF?kvZݐzCɃCx??|cGw?\⇬9ѹѹѹѹѹѹѹsBD跩)/>w{ibMBc1pM_ۤѹѹѹѹѹѹ -/ΟNY_d}5Mfynk;h+r&!9;i?혬bJ^fc?InfެеgZk(Z k(Z k+^ 0?-Ṵd;B&Z1% _ABP-} _ABP=_6W@:펻2&Nlֿ63RzB^De3<r\nw hΜQO/_) (GMW[9@MOڿn,rUUV펺~^D Խ-UGZQTE֑kDZQTEUkGYd5UNٕc>@l?KTWʢ]U[IS50kvmr-r\"*\$ kc$M/Kytgic{|3]8l\u.J{g#jƎJ"{"u0п%l -׾+_ռ_J|H~']\V8W{nY*W*E|r_)SFz펺~^DI4/n:^0 ^^-돼^ay!fB03M7O3+Umϖۍl'LWV1c$M/KێY"9p ,{LƧ[h5[PZL/ 8`hy9u|C:y|a4Rݲ~@3}*Y1r~aJ |###e\r*I~~[KLXy\:&^h魧N2wmzHf8.vC\oWGbYx{F>G:n'5*>:"h> y0y"vZ=c=<>Xk=o&wFa a ~ nj193:tQ䶙q,"q,"q,"q,"q,k#CW;i88888`LKKKKJ5dϳ=gW h3045136 2!@#$%P`"ؒ5CfgBKZ.CdnuA8=]!(ʦkZT9 Cd)Vm̙˖=S5|Z⻩D&d]_!<ͻEGtAr[)]Z\ID%Hp\zIb* "ks[u^+Z\qV(7yEPXKic ,a40XKic ,a40XKic ,a40XKic ,a40XKic ,a40XKic ,a40Xrv9ٞbM4xqAǍ4$pБBG ɣ'W#!V/fܓ"{E ίs zԾ07)TVmxij=8R~h6vo7l5:8ظ˼o<گ o)51_gO:o=j_-jS8\֬˵aے0<ãcT4na%r\2Ǝ+#LY A):uDs )TUlKc{w*:rY%șzfҩoH""/H""/H""/H""/H""/H"('^$Mz>,ONB^ɉ''ׯBAfؒb ֽz/iVEzD^EzD^EzD^E+:e <;)5 1ٿ\Ps(gʶ-&YX}-c4ow-3vZ9'nR˷nA?F 7PnAu 7PnAɔ)70B  9I?6:دoَ+ ӝ}C !1 Z?ԗzG]sՊt.{q%w)5* 1Lo QLe P Wؾz>b]l=(q2Jk:xDOHuaQ>V#k&Q0JD jZ0Sjд-6xe'!T,l%J|~1S / / / / / / / / b)ro / / / / +;!ZCI:f@_@_@_@_@_@I2Mb툊Rax&JWt&g!+uaQ>?'Xb~,Oʼn?'Xfjr UtOIG9zߓ5"9{b~'*ԇVSơ \EmQIU J5JgDzwTtѧW"7}3=/z~~"WbC5HfxR```````````````̦C};lQQQQQQQQQQ8zdBBBBBBBBBBrxE9!pYR+K=rƏj$L3TfQ5Fj3TfQ5Fvl\D1DsTfQ5Fj3TRp'vb^W23TfQ5FjIG^ѳY jl3TfQ)C$D-Z h2eA-Z 0ѲFJ (0O`  )*P82-JUZhA%2Pa*PHDS-NI:6PhA%0tM Gma)KhA>ICe@-ep,9FٟIbT{3Ι=tf8:E=-)B;n qW;%;wf(ǞP)7Q̾UG3PEgl?i\. pY0eh Z`K4-2/ى{c֥ϤJv/IĽ~ȧvۗ_d1I#@Hq!@Hq!NيA:C  $8C  $8C  $1'\1 g@Hq!@Hq! c䎙DsljVg.(= 5Q0FUj Ta5Q0FUj Ta5Q0FUj Ta5Q0FUj Ta5Q0FUj Ta5Q0FUj Ta5IuSgA S !14Aqr02Qa"35@C`#BR?ɤ~s d⅁PasMOCzez;z:7vvu- dO/ԟz~lb?uUm3lu1!:+g[?;=u!MiJ}V5bCZ}uTާۓw9)OAC%|M2n,Bn,Bn,Bn,Bn,Bn,Bn,Bn,Bn,Bn,Bn,Bn,Bn,BfC3!qw]UQBɹ}Iw'XSP-qnz=C-9a}NC ZnTQѿwo5$U{}zB-^fU-h_E/S~*ⷳ'f|WG#Gc$ -$ -$ -$ -$ -$ -$ -$ -$ -$ -$ -$ 'W('rϽʢ}TF˯Uv*捭o*{I֍@am߅ 3ɍI$ I$ I$ I$ I$ I$ I$ Ͷ3*\;FnZV:bSrvQ;[U{GX\ʎr wrWAMoh%\tL],԰Uw/hs&\$fN(Y8adY;fN(Y8adEg u#((Y8adY;fN(%Ei* gxGY;fN(Y8adY;L`d%';+ 'w,Q ٖ[L;( ReQ1uF.Tb]Q1uF.Ѕ7왅 v0+frB8@LTb]Q1u@Y>F{zvT&x"|ʩuSỐ<8o&Sa~8ݳJݳHA8\N x,X#}=' ns6x,X#}gn/ܱ^5 #V#qٗ,WBՉ5o޺z-묷oi olBGl % #V+;}6*d8be*c3qF(T,X~PO?j&U #V+;}TʟʙLsʙۗLFD#MWJ]]+utҺQ;3 utҺWWJx]]+ut人WWJBXD $%J !1234"0AQqrs Ba#@Rb$SCP`ct%?CmDV N."9q45Y- Fr5ſ&y\o"<9uX"(T #_ v ^@,RGtG%" j&u8FKUN!҄ (p \ "lS^U SEvg{-WoR`4BE|2~U46"_: -2ꀱ@[Ds` hWSo+vB#Ÿ,݌,@5(|zu <IPpE\.t\pyU&ۗVVu|nhƋ3*7 Q,+N9mg|a O&ͬu'1q-7< gD|U)-:XYbY9W w&y\c6𦑈G Mʟw&x]X.ؒӡcV5ٻ|7z/fElmͳwn_6ދٻ|7z/fElmͳwn_6ދٻ|7z/fElmͳwnMciT-6}jR4-D 0wcTwgHmb'bʴgjMif-^I©TFm_[E^>G t٭څgB9H_EX׻)25V[Sϳ>l۽ͳwn_6ދٻ|7z/fElmͳwn_6ދٻ|7z/fD4\\><]nS۶^h' ;i5]+FB=_^"6$Xؽ٬Ҩri20I6W$>0)K#EeryT[8iU6zJ{*/YG6? ݻnɿj%%ȺRU]T4 L+T$K\9m 2{MU516r*FeHoꨴ( Zsߊѯ_޲m?v =Io+u‚I;Z96ZڋCQhsj-mEͨ96ZڋCQhsj-mEͨ96ZڋCQhsj-mEͨ9z9X|4y$mZաͨ VW(^Վ&goCQhsjaW{E2jZڋCQhsj-mEͨ96ZڋCQhsj-mEͨ9rQ`,ȺQ(d=968k9X%bX%bX%bX%bX%bX%bX`_.bOTbJQɬ3ž%bX%bX%bX%bU9"ddr'E \.q $#GC2Vr(j`<3E|BvKG7Cceg-|Oy\IVLnQE<?ZM3*Dx _׎U Ksh * Soؒ u*HS[# h.h`_%1SNp̤4-w_Z\|(*28XfxSJțRWR Iߦ6hʣE8o9R%upʃ {co甊Y 2z&5ԙzՇ<2ݪT ClUY.M{1l1&Ц<\,cF[VEpT).hqv+kSY?ҭG6s|c?r.Qkj[&h)? ͩY&?*BGѭR b^3qTό:F];IÃ0ZsW{u,vd˴+("B#.9~FLxA3ŧjɗhVLBeS Z>7vjcdǸ[كȗhVDB%=Ir+ǽjcEd{/`uV%.Ьv:E~:s*p@ d}7Y8ևBX{yq(QGhq5 ,qZppt'E >6yjhdႡ7rA809:S> 5x1w!Q4F(΂0=O/(8AaPDD8VӀ#MTH~nȺG{eȝ;fiބ8=LLÍBrJ־Lν/U (eqK*BhȮf8c|@:W"OMO=_OBbbXCw)cgmX¡FVMk~=UZU I{ْO"п~Tlw?H ?r.QC3qRuJvAQ;A:Oy\LNWEz^WEz^WEz^380:o@Et1WRH dt2E ʱ508]`}{Ts:Q$u_T%u*`.&A>ԠYhy85Y5И־9|4x{#LTR%h.ջfX*^q8TU~/ÁF3xe( xUѱxXyԷmѱppJ88D4x{#LTR%h.ջfX*_5/Bg@Ty(Ftػ4ȺPm'.z:'TG7uPfX*_?/mcUa#e;PYCe;PYCVN?̞qRlr82xŗ5k)))))))))[gN`5;AQİFHY#dJ;ZEvzܲGr$w*m?e1 !!!!g{ ^VC{C{C{C{&ֲr w))m#&{i@Yd;v.?r.T>佧hxɺTNqio+aEH8pP^9]LLLLLLLLLLLLLLLУ@%O }OE$/l֘SVLLLLLLLLLLTx5+jvCO%77777777777Rb!mV*ԋEpɟSzɟSzɟSzɟSzɟSzɟSz7eՁ>.'H$IQVn]n]n]n]n]n]n]n]n]n]n]n]n]n]n]i "$*m2G9yEMuT#ѾBZꪯ ˳r˳r˳r˳r˳r˳r˳r˳r˳rɳ*I0Mxd팻B5$јýn˳r˳r˳r˳r˳r˳r˳r˳r˳rRr  =!Ԝ*\fz+2#ln]n]n]n]n]n],#FW63kbX ,Ab X$ 3*"Z4{@hhZtmmg~oJį4(.8oܳmb-ôNeDFĝ 5dG Fh-=E uvrCBq[rEYv3X#,IG Fh ƸaJ0+peoן'[f",;D VX+<4ZY{pb \6aӣ~SnDd8z|2d/ >L1S*`d\4Y!UOUH98TB{+șb4T> Ceѵ*^\#x.:ot"ǂFߜ?p`i_ha_YD*S^ 6aA7 `W}dP$(xO qšyH5T{"F&m %2S'}U68? [,OpȰch¤"eA-k˼d;l"'PK`X.;T'E)#{ةrNBzɹGPyqt̩qNaP&qruJ[M;cghAhRkI&ZhRkI&ZhRkI Wh'I&ZhRkI&ZhRkI&ZB[*MBc`mvФ BX- M`)5Ф BX- M`)5Ф BX'7*\$oEQ:qP=uYYYYYYYYYYYYYYYYYYYYYYYYYd?+!1QaA 0q@P`?!رOT,tQĄAN)6_L|"Lq a@(Qc&r1!Qjab0f7>H"I  vB [5 sy)\18-81Bf ^c")($g"fUL5'dZcL >і7{SKLń̐&?` dX Hg 21Ԝ@$f@eD?A|2: O''?ICM7ZctHe$2>,tM8|M4M4M4M4M4M4M4M4M4M4M4M4Fh4GUrT%CQC1 xpP"M}c:)i{o!0z?O(s&]҂H !Z{p(ĈpBAE Ƅ^E FL D=, CP66F (LχDRN$c6lp(8CICbB0A 8!@f4a!LCd_>BQ*@?ULM QeHfDDdDLy۬W;"3no@4O @]w)2^ iCUʌw6OB@0Z| ۀq8. C98/MFAOV\V[oE[oE[oE[oE[oE[oEC@BI3auT PوoDR`AC-跢ދz-跢ދz-跢ދz-跢ވ[C 4aU T!V VZ+EhVZ+EhVZ+Eh`ُH0h4HJJZ & 3#D`UVZ+EhVZ+Ehs44rYU0U/=L vRX&z3?>Gk6}E3 ( J`f@&Kh;3`$S9ا4ΘZD۪!wsp s̖(=UfC!4($^tE$Ld94e9Gf8" 6"OC]CR6e>t@I 9#ؠ\CYU9?O~\T T@>Q ef=%}Bc Zr =([֕!@zk0ԫ΍W^\/*r-ZhuS9YTcaϛqǖë$jr `ƄTSMO[ %PAiRXd0.e4,b/P Z,ho k1wbFSTkg,~֚5*VLf YvYGV{6q7b=pMi6mIm&M,I4 Я-i6mIȀ>сw dgXRC A(7-h/KAzZ ^-h/KAzZ ^>B$3@Ql||`-h/KAzZ ^&>:!]sF-F#H^-h/KAzZ ^P"(K|#cX0δ-h/KAzZ YZ==2 5Д-mn[rۖܶ-ɾOigȋD(cm/ŰD2OH":%!KC|=ҐG@X !l/ű?C.`N_߄G@JC_!"92 (s$=1+a~-kBK' $#2! {H;hq 0Frq*UO,lC "1(l|NF4ƳI\CPQ@?bupOHLȀ4d``C}cr$Qʚz00i cwB&@(!Jsfgtm9"'OFBr@0Mј(͎u!H["aA"K&<f[%v!l(ĄLOr<êv+C"2 Dnӫnl4/QͳVG/MfG/H'q Y0I6) HC,,P8PYeYeYePrHDր,,,`?I0%gf3Ͼ33 { WJUҮt]*WJUҮt]*WJUҮt]*WJUҮt]*WJUҮt]*WJUҮt]*W7 <<<<<<<u<<<<<̽w<<<<< 0 0 B 0 0<"8<<8<<<<<4qC,28 <#< R0R<(ҏɈC$v0$z}&(?i8{)y&&&&&&&!%jVEg=K=n=ho u/a_bV𘘘 542kӫ3Ohx6h:U#MJ8wSOh=\[Nw^iǫi9N GPê$ ؿ/% [qI$I$$Il1Tӣ$I$xֺp$BIJNX:&ʾo*1a!Q Aq0@`?b{qIZ+ Wx-er9I-5VwiOZLbA]:o)~jC\ K gIĉ =K>H,Kı,Kı,Kı*P'2)4I6bI&΋,Kı,Kę vcCMìWm6ygւ|ޓ:lҏ'?vVw헰Ŝ_  /_ CBI@O-c4 /T;%~}|Rƍee3%P:E+"CO_;%~MMMMMMMMDViȗIM/HRj9~ɩCʥѩ)Gd߯An8/5i^3^m+W{_2|t8=_;%<7KcM|!l9mυm CAd˯-YJSXvKp2b\-IpzI$ +?.iBN^: xlKi$_s^FdaN;daNўWV;daNm$ݵٓN;daBL2w"+_+!1AQa 0q@P`?؜I'S`!DSc "8%_s/&D0ٌ+=gBb"AlNIh@Cx5hA*t tG]̬IG{΄Li`_Z0 Võ =SH Vʑd!LwѤ PqD1-V:褈ܽK(9~6, ˗ r(%qvpPD2$/ ƶ&'t0"$p~ 0h>2UWRBpr0Ͳ9N "&A.R82y(&Hp j%':d,ĸğQB/ps86t->R $ +2A̶H— YeέpԜ"b"\'b#֎$n0 IhgX&ZF!qu`>B&ol@- S$m fIE d8 &8U@ E5k~ ?P*M$AZ=?#z< 6١"IZo%d%Ē)! &6 ӿ["9MbruOo$Jp.K5DO{E\~hHDf"ݚο)lhp-LґM ^2i,~ (LSI%HLB" -* "С#uМZ$S͚a"R0$:4pOcʣ̐ C D)"L5$:9!GPO}6 6QiD`Bp^ВOIYtE x !LN]SИQ)%a6)F4ih mHYƼDƓ#K)U沠 Cz&BcSޯo:K Φ;%BS* RHI6^J|,09)qB (PB (PB )k) ɔBIn DJ )& `DQ 1(_ L'3RP O,230J*0HBw$! Q¡Sί(PB (PBXoHEfLXq:>9c1kϥhcwףdooWmW;w&=i *"b'1?⚵`,H4׳pB)͆4 0# R$:Qв$99p_mdwàVݥwF󧀗F _H[Wm^յ{V[Wm^յ{V[Wm^յ{V[Wm^յ{V[Wm^յ{V[Wm^յ{V[W1i&u{TX(8Mu3m^oEHnr͑{V[Wm^յ{V[Wm^յ{V[Wm^յ{V[W0CU=o:j/s졣2^x +W^x +W^x +WAf?SX$Q19d~U+S'A׀^x +W^x ( PrBTčO-/51x%zŚ("W*2E$Rcͣq[nn0#/I ? "&#Ao:x7ZP e$^)MEnBv.R"0i*@I3 fPW29dp@H^}8jEc(grf6I2CC8б%-dB`quVۛАbNb[d2*g3Ӭ䗡\{[鵌H}P #y3*|. ~؀V,A{J%J4@??&?fxCUꋙT:R. Ѹꭷ7Fq4#jq)2W% J@8M ! ^C^C^C^C^C^C^C^C^C^C^C^C^C^C^C^C^CXNbcβʽ۵5555555554I" AbאאאאאאאאאאאԮv< }!!!!!!!ȡ%F('L3 TQ\/Wf@Se>~zҒxf[0 +_b[W/D2HQS1Qa Ig2RlP␒b#Qj$== HN?4,fi ^i_F#y]WB1҅5€Ew#9PNJו4??Z!艌 2vC\κglDŽ @J޶wzM.Q?ӆ 7]#HM Ǐ$OO.b=diZa,^ E&HVJ;CMl^{^=u.b>(d`K11l^{Sc1*3bڂɮxD ܩGbAk?crX(_4`5e,яcsNLLH&|^$aѿ|Ht@PĤ$ Aw(tq(qg/L{Xŕ}0|$ԅc&OL y$%9I=%a{6rl#N"7"G VբFv@2rDF1ѿ|Ht@zoDP$pRFs: a=ٳ譫Gr|""Z2[ne Yb=.).Di%].оc匵U4D?^+zӇF#y]Iش)m U[ gDQ,ӳg[VD0HTD% ia,u wPIfm*Qˋz:NčMtw->ڴ{[.!.k~޴ѿ|Ht"+AkAkAh>MDY q[vj ںB P!2c^ δ\očOtO%!SGlX-I06WN. y%(!B0 q{Ip5h]tn z߲| W7<`z59:r @Q! VmCYʭBGaɧ|q|s2R,ub#YL1!Zmd5h]u/P][W^q#yIWkjl}^쮽FPգuۣCuB>g׫Οz R!DZcw޶7zcw޶7z4W|Y)gA."D2޷z|w޷z|wޅ|ov T B>2#& [#l;[#l;IҎ # \ W7>9!X5!) V[we_78UknJdqjLΟV/ Y %7qΉp?IsW(AlղVNObѣE `]evڇ (F !-H;'ܗjQ!uq?8.ljCd1C@Hr˗.\r˗.\TLq˅ASZr'˗.\r˒p `N tJ$?o.\r˗# uKzr˗)srTQ.Z"7MU9n2;SdVZjիVZkz[$AfF*3i1R ʀK8$MZjիVE"' 7E,0V`m8{NLZjիV@r`!V[# 8| ζbE(=mZjԩ(D艘H"j"Q׌WWWWWWWWWUc^)M5 3ヂeVZB`ɮ@F49pcy)COh5lRJcR8^"6F=X2{ѣimV X" MvՂ)B!@IAZSuM%˥CAU>E$Jİ)Ɇh,k58-GУj+& g`I)>' AxetDtDu|"HD4Qq=yY q*I! ~\~I 欫4@mA`kvJ`\!! !))Vh$Bs\W5}2^0(70@e"'=T f n~T yIsLbs-V!1FQؘz:Ӊ҄!?mZ6O:RÁ2(Hr"ULs m0$EÄW:rAE-K p ,Yjx*LF- '%1/"m&vc\QTRtI" \A֕^;~GĤl!L8ÅE/cp9!*>pg'':V=D@t}gf ėANI2QZkrҋẁ1{=#[ 2<7^CÛ ,7Ēx8iFsv፩ a KׅA  Elj!'k i13~_@hꁥTQKwXVJ*onTw"hnS- Lo/(efjЋ<$!PȨHU< *ZbpyTfZ|1h /(@202cu?shԥ"&LiB9Je7^^H9b F53 "$: (Hqp5z9ց Z?~;3|`qh%a014(*ޝzvڷjޝzvڷjޝzveB[s3YT3uoNս;V[ӵoNս;V[ӵoNս;VO@HlRIl-[ӵoNս;V[ӵoNս;V[ӵoNJ,D0(rJ3PB 0Lx#0?$M8&Ap.RƯ%QEQEQEQEQEQEQEQEQEQEQEQE+ )왐@-p endstream endobj 71 0 obj <> stream x{\TuÜaAT eK7.r2.WVҠ@~[yɒEE Z(%as~5>˼̙awX*JOkTGꡦmKdNn{u_alvNjS,9csdΝɎ|"gAJt$t-M^\de ̞rN .6lgްifwZN%+).OpՆv[2wev~zm̖tGK&.0VyϋJ?IxhR􀘻'ek'yAA|"ohϊ=.VsyK^qg_԰mn\4|J k_f;ݨ⽣H`2/vb!ճȤgmOṖ&q;tӠ[ J?HL&I֖ߘm{UQKWGV>[BYm_vdpms4KzgpxXt=^O=xձϚ>{vw*hiX lmon0W|ٔ}("zI&[g~̈۹v26Qg=_%8rJ5o'E&6)\OFj7 'XnW@^[m&듖%ny?p]{Dc+ 9vfB?XmN&*2L~%"s *I )}4x\!M(c Cw+?pjc楤df7U F߬ nFvwu8vvCLɍаEnίAM:hdШr&B}cFH'7ڱ{1--}[ߘ J> 49J3vK4oX_|aʼ#vT0{+ؔ*t@+ߔup~S?weٙڷ,9k; >]{Ed;2Vvs誌͟e<]iφL8yc1fޱ$}c18N)Xwuן:g?ng GŭJ*~ Ɏ=C?J'mfv S? ӧJV' NPnm[ TdWm~Yv`4?#ysBȌ-zOwJM9Z]L?3G}fnAA\!evWfN|}'At3Viߪiw)WAeJ+=-r|.+=-WYvLIvOюG]Uv$ (F;Ў. B;Ў. B;Ў. B;Ў. B;dYRюX<.G;pig߆(B>$RҎ]i|ָ0;\t^'<ǟvMij/j Bv=LU@\g|+qf|:t9OeF&1*WGbS'o_mv5hq΢2WZ[O:Rzknk_.~q};nV{餌Xp:n1ӻpUԓ O|?ͺqj?刂0 7Hח* 2G#A sԣ&:[IKt\S?1Ip_;UЍb&fWBmޓovV1ᡷ/{ft~.7*IgnlY?aT)[k[HWSz6bxfYaS7~a7k*Ͽ*νk j}[P6I#~Rv;>,5 ? |_yk; 'siWOi', PzV{uDeЎ. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;Ў. B;dYRюأ.j Om1(=+D.J ҳh^OX kva̦8T+ozwxU٣t8T#/Witv&oCG@3o; a9P%NlNZHQ 3;hJf4FxԎ⭛CDC9lvTov*Ss\"#6ϭ帻7HUugp=![Z\tM ۢ&?Ե8 ฀MޞcNn1?"ѥXKn٤I B:q{iʚcG)=+oBgbs ]WɩZ3 {% Or ,E˪Ǐ9.Pxr,jBmAXJLݭJu]=?RB\#XQ/~LʍԉFIK Ҕ{ z O-.ڮ}̷AMcdva띲߿UN endstream endobj 72 0 obj 3840 endobj 74 0 obj <> stream x\M$Ir@׆{@SU-[NKE_#3+{@b,"G/zَZLo ?v[i\z*O?..q޾寗/mORSdݎbG.eLMP&w'Hi|c<%b^ڷrLez$jgPxtrܯ׆ڡ^9;8ABlS۠R'9n5ʊɑQ#5:L˜*$ H!O]n츮$: ?!}hCcqLxvkɀ (ۧ~yrh"ӓ8͹9W'&2@#idIgT5Zl#L!e MBHeM:k>ؚoM=5gF@h f@*'$da!w&jQh'O{X 6^l d vy5KoK77Z7J/zIWᒦ65_ (IXъpJ]VJcT')BnЦ,B0W% RYZjN7Qe`۵-z-0W)s5ֺR[juj{K/l7KDOC=u7_{foɐw-D3F Q ')E|3ᓡ]&$̓"+Td1"@  \S,vph}D6nEM(@PX#(,$BWm ar5VAڸBT|.DsD!vI%PKP5GQ< |g\ʙvQA۳;64gd>2{CVU,)3Zӄ!M @dwOIؒTJ(йLD54 hrJE35on2šơZ@WV4*f>ww E&硃U. ^0 GԢkAemK*K,R+xq`D lbM (;snʙpH䀵ïKµѤ' ' {Y y(qI|1)VW\Ԅqrfrb k zCٗl~4]qUhCE (& gH%ٳ%w˼ȥȥ;A74g+ڗ>ïa~Ou@%syo /Eŋo AzIRGnUXPD:}V z)ʳs}:;~۱z?Y])wͿutڏy"UM X۴M" "OY,/xvFe%;M;ϚMmn4v5aIj(KkjyN8 MKζBas\kWwז~\~rG@|eLК̺eLfryFnnKæGȪyxyo)b{dF~AiyWw+Y6#OVմUu#kP'˦aDžJnfkp3=w75iyn{/gj$3vR?9۸j僗_ړ6S uaéW j&-2~ }q% _YLtv^AcX-f8Bˢ|{O{fXkmBzKyNG3eJo+U%g8z1ỹ&1y}|%6 U?sw_[27*^~O^;o4꧋x-}2'PpD ?ŧD[h;x1{c/EhggQk ̉=:ono=׿nŽүN=߽N*oOւd*qqG T,.?Go|IB, endstream endobj 75 0 obj 5479 endobj 76 0 obj <> stream JFIFC     C   " ʀwxVCvq,Yu2+VxguZYu&`j {|YK.@d Y/o=]ie֚h @sfّ׊Pb+mAPb+쬛WqP.l1 c# ΅hoǪj*TRRJZZhjr }P_<^{˭44a͇ⳇ|L öeö2"R&"8g*?`>E%qCrKh뢽 +q?ag޸8WR<o|q\Ϭwjx+|O|\g9x Y/o=]ie֚h @aog xWV,{9;Ɏ/#^ZiNW!DqnżuvwR71>VBVB͊G|etYE{@WC~QJՔXſylDyV1Q0)K<_L`WŞ.M4M ؘߏg1Sƣe1Lj6SƣMɭ}UBڎB 9Z^, ]mǨtDˣQ2L5.DˣQ2L5.DˣQ2L5.ER :`j {|YK @e=~AkEEEE_ʹ{|T[e֖]iɤ??Uk͙AuX/m@b/m@bFY)vdFNz|+Um m m m m m m m m m m m yȃ@YX/*U*U*U*U*U*U*U*U*U*U*U*U*ZNg@X<3g˭,MH{<~+8wȏ@v{.?u;.?.',b#v~"h 1RW1+4κ+<^ڗҬs3ڢ]I'^.Tp-IhUt ov@Sw&z<DZ]6@X~ڳs5''xecB=77eȦ$@g&(!z')ޚ">/oljʭt4ac+9Ƽ]8|DzQ4'+"8ib:;hӿ+c+cE8S/|Kh뢽 +)+Dƿ9JNpWYi0?[ŢyݩWޢŲЅYщ<@SW-5}yx*V}T?q^vz Y1\j&*-^_tQH~93 `j {|YK.@dlc.b:cXlV:œ9c?N(e!B(XsܰۏS:e`jvXe`jvXe`jvX3bKk2Ee`jvXe`jvXe`jvXG$uh*-K.@d=~An|_<^{*˭4Pt d-O>%}|^O"nZn}0_<^{˭44bc]-~3?Ο=X1b*ޔ,.\eWj|DG,[Qmu#vk~,~,+eWOimtW*[j FKBd&Ex߸=.dP{1t8p=߹s>y\!GCagC:~_<^{˭44a͇ⳇ|tMC+t۽+J'䛑\%ť$LDqnżuvtE-KA0'RYi bx' bx'' wMJqG, ՞e֖]iɤ=K0̂|#_2̂5 |#_2̂5np૰2.<.<.<.<.,uQ|HQąxHQ!GxHQ!GxHQ!G_<^{˭44+VxguZYu&`j {|YK.@d Y/o=]ie֚h @O+k*}6RS`Sp4 4 0156`@P23!"%$6**fh1ZrkkOukO:ͭ?76l|{kO:9KSWA|4A~4A~4A~4A~4A~4A~4A~4A~4t_+O~ow׶9oxec+1X V0b`c+1X V0b`d.{ռ#7N0ӌ4 8N0]ډ:vdG0 80 80 80 80 80 80 8W]x{c?ux6.ۖ_RF/U]x{c=2iE;ܰHd_[h%v#:5 ~\g.+GB9qux6.ۖ_RFn/F76<^KyjQHrՍi,J^MNj*>`a߰4gmQf兕jõBsۺ]x{c>O-`HD5/ e"Zi(4ļ#y%kMy8eo[kjAj lFߋ#yqĩ2ReBM@XVEɢT?B-1"j*%rPEd2.y#yo~ow׶9ozUGUGUGUGduTuTuTuTuTuTuTuTuTuTuT]=(sbwDtLwDtLwDtL*ڕ 7x?7+E1f$bAf$bAf$bAf$b@k#I^!*26Зchɍ1& kDm'mRYI9?Xg a3~?Xg a3~?Xg a3~?Xg a'rl~3sɚ%̎%̎%̎%̎%̎%̎%̎%̉ˡO~ow[s֟uzRh/h/h/h/h/h/h/h/h/RԿ 5=^abJhF'18щƌN4bqhF'18щƌN4bqze= ];I ҈4 (J YVՓ[Q[wjU=RڥEdHIօS\~+C>5)~\++}y"9Vl]-,4Lbn +x7jud!,qڀ=U\D>xEZ5Yc;DsD y+͓HvMPs/TTWiјA6l$B-eM)˂v=}nh=M89x_QijJA\N%Ur-jo=C4-*wv#A!.iaPNjR%m-b 'k6+HveV:nCo2 5C PT0 t$j7q*B1TŪkHڑ5Io4L}Q{%PqtGLī#!v«pEqyǮ$s^>[z\є3wͤ=;,c&tFM*";[AXPskU+oXjdU.x <n b-lsX^GfQ٨:UGfQ٨vj;5GfQvSxeJa;Gs(ẹ*4EjRD;Ib0__YO_tό!JlsRNIPfmAPfmAPfmAPfm@{ȊI^)jsC1ima/BCHH%"֍m~6Y3{: * 8 * 8 * 8 * 8 * 8 * 8 * %.Tmj߈J 8 * 8 * 8 * 8 * 8 * 8 * 8NU>[U^w׶?DəZ&J&J&J&J&J&J&J&JOڅT{kO?=Kn|{K1#Ghh͆h͂$Z­?7CRbKKKKKKKKVэ'ķbn/!n QT`5F QT`5F QT`5F QT`5F QT`5F QT`5F QT`5CQlsY.֐**r_+Be߫ls =+.ruheHU9R#w֪͝R&e"$nK[vܷJ7HEȡ(gkӔ6n[Rt^Wi^n^)KI-x6arL{.>k~\pv]n[>u%ƤԗR\.{f3~hKr +jI-%n!#pZ gcN frHgerr^F(X'^iW7K#nM!'qC>].&z)mN0"?@qO:; zer s7 VYC'1֚YMsޭ$V?trTʃPw*@_Fjy1!չ7:6 5w:3)FH${oђڭmwuV #(0KUԉ6 Y1NNݿk}A]~ow׶9o9<;[>opļt9ƒQJ HҴajuZαA#y::z::::/U]x{cGK0~30~30~30~30~30~30~30~3Bw$p<;G5fS+^&&&&&&&& qqtXfLdfLdfLdfLdfLdfLdfLdfLdfLdfLdfLdfLdfLdfLdOH,vuֶt=}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}ߍ}߅.?76l|{kO:ͭ?76l|{kO:ͭCRVAU1vY701Qb "3Raq!02@PA#p?ʱ\b؜+o}~qj& ᨘ0^b9ҤNH :"t*DTЩR'BG9]BK͚SiM6SiM6SiM69|h5 b7-؆?Jb$ Z䟗ƏQ0 `#.%dɓ|Ol2dɓ~? D،^ED7MS7MS!#SODJ~4~qj& Xj4V'BNX :bt*UЇuzPf6SiM6SiM6SiM6j'lSiM6SiM6SiM6+Q%+cL/}VKb(P"D$-IGbER%HH[`@{Fdɓ|Oٱ2dɓ&"kَfɓ&L2vl~ED7MS7MS!#SODJv^"[cL/Q0 `?o Oܔ Oܔ Oܔ Oܔ Oܔ Oܔ Oܾ4~&)қJm)қJm O{=gL/} $H[!?`Oи g;/`@{F&LJ }ۙ}ۙ}ۙ}ۙ}ۙ}ۙ}r.? D؉ b(;b(; Xʾ\fEd\fEd\fEd\fEd\fEd\fEd\fEL/Q0 `? D5 S9 S11Qb !3Raq0@AP2"#p?UhFE?NֵR_wVTwVTwVT4M{U$w$w$w$w$w$w$w$w)hZoV"Lq1Lq1Lq1Q=mVT~[`EB$c'xڸDEV R*X kU;+8]?bV$HUe7'?H,EڭAةYž7(bQ>4}Dh#GFseE<8/:KΒ/:KΒ/:KΒ SոRT4M{U$w$w$w$w$w$w$w$w)hZoV"Lq1Lq1Lq1Q\.[Mq1Lq1Lq1LpWEm[R|nUnف"Eewj- \FY[[^f*j'D 0j*sPv*V1oʺ[bĂ l'xK$AmVXRn@ (@YAةYž7(bugQugQugQugQL˲^xqiy^t%Iy^t%Iy^t%Iy%nFn^t%Iy^t%Iy^t%Iy^tAةYž>AةX<{tR1Bк4. Bк4. Bк4. Bк=pTnjJ-VXQPk&k&>G?I=TP~ڭAةYž7**Z- MO;LD#8E;>8Dnia[rvHK$ ;i?IU ȰȰȰȰȰȰȢjڭAةYž7( t/)^SIyN%:JJizIHI̘ɏ̘ɏ̘ɏ̘ɏ̘ɏ̘ɏ̚mVTwVTwVTwVTwFnG ZIQ  3!14r "02AQ5aqs#6@BPR`tD$CTSbc?^jFVZ1-z~{Oc'[a/z=Fb{Kx{<o'=f'[a.>B B!aX|D,>" B!aX|D,>" UYc/.OG={Oipb{D]J(@=sbX1`z,\Ł똰=sbX1`z,\ŁqZ4FXk9Z 3rA6b<A C0t <AĆ֪$$,ȋbd*|E5R2 :,N2 :,N2 :,N2 :,N2 :,N2 :,N2 :,N6'hQdx{<#&?|=o\BO=~ߪ.${簌'Lnkb4G#>ħq|,%F3I"DKRK0Kv֣YQ~ߋ78ҫ뭛J&(ғ.J+uê-DWR<\}xԦ*. 'Oubf2IZS}V&u ĒWsa6I'E ֵ|c//@GBKݑ BJw՝ m'WQrn?)?_X$?. 'Oubf Si5ʱ6KiM *9Eb68jZtrʇsv]JZ Pbl"6Qk9&&^'1 \rEՠIQ\6WI!O(j)lRA Ieg/kHN.GI r9 }uEI]&$T{Iq$n /[2OG={Oip=gGpڜ5|G:powǖneP?Y*B! Auy/닥GJl58yRVmƎnt)"3槝DIO C:<)RyH$?. Ի=O6:^A/V>E(XXawz)fGs3?ZZP)_iiB9J!trۻ^Tuic' HnR$ʀFu/SIQtL^H%Q\_g^v;te.l-)LW j%r Ӊlp\\Z*MB B!aX|D,>" B!aX|D,>" UYc/%E8K[L={Oipb{DJ(T 75śqf渳s\Y,nk75śqf渳s\Y,nkTNaU!gapN=84p`W"ȃAr np"JX, J̈!Flɻ)R2Lem1c+oTVީS[z2Lem1c+oTVީS[z2Lem1c+oTVީS[z2Lem1ck:xN T_ ;([z2Lem1c+oTVީS[z2Lem1c+oTVީS[z2Lem1c+oTVީS[z2Lemꘔ–K2dαz7Rz=Fb{K&t~rCQq >.fgk~x+b$t}gu'=f'=gGpFZ*T*}/iTJ#4b"Q/I uP0gAF lhJ:p FJ40IYkYCM*Yb;RT2EFjS@p&1z}a\pi&.qB&KJa8%oHWO:H#!)|Uq !zv[-_u 7t>t*z9h|-B%2E R _aM-^kqd t"L3DN/"nNe"TΡ:J/e*kU|GUƔ m#E1O 4U5B %e2ۊĕ,4|rQc+ 8foT)P1^Ce:vC:wS=Gv}=SE5Ғr jKY&Ip}G.ooO= IJ"\4ӾthJj.I0;,8Τ2ӾD6ʽD'_}_ c;&?|=o\BO=wwm}&MVŦt T16Yd-ȍYhNbHsהVM$յyu q-3* R|b1]S^922e$djlP!%35QUd!¹9WHfHr(Uo~s R8 ʌҕ:CPUT)U.\;sXi0Fo:P9 ӻPD7W`dS]ʀBEgRi5}o{J ,R ,οE\Z~[Dpi]m4N6([ yn1YN90PR-K>BJ5~J[Q"HqJ:TqӇ@p:5ªc_ҳK\ʱCAU*M|q.eJ꾑,B2}8ҙu*JҚQ ~p .GdgE(&:nSIuJ)e^I={\D'LqKq qhQ duNQK8ګ6|dGu}\+ )Y N$]2ToCF̝-",XQaW"F:[uBBTG.8K7|AˀyzQ:uGۆUz*)XHt;)jI)Dh"X9Di:["夃WBo(`ۣDw1M-NTu|D3h\UTFh6\eɻ).Fؚ٥* ʯѴ{.L_27SQROzK?@9_{Ec.,ĒXR'օw jI"+ +*J~J_1 3]SUxJ.S&4ٲLjTnE8ia1"iqсJ\K&kպX %@2UO;:橃9W: r1:}Te\R2?0G10T>BORXPn"D}4[M]Qz="oH[-xzE="oH[-xzE="oH[-xzE="oHm`ԔCf\[͡f%(oH[-xzE="oH[-xzE="oH[-xzE="oHIu7TѦ+ͺy8GO!Fb{K6EJ*q (P (P (P (P (Pe2RIh"RFa/z=؎ED?z=Fb{KWU"=M6J,,,,,_̴ZFD\ߢ{簌L#Y;{q 覰c(gA2tc(gA2tc(gA2tc(gA2tTFEBHQq >#}izgI&=G~#ɏi?ǴcOy1'<L{I&=G~#ɏi?ǴcOy1'<L{I&=G~#ɏi?ǴcOy1'<L{I&=G~#ɏi?Ǵ6`5SϏ=y#1=G:?a|ӄM>41z}a\Qv'=f'棠gGq]?2΀C4+J dKV$ӄkX*O5-D5+&$6:#٬NdW[$ GA>cw$?. 'Oubf!F)D|"RATa,bC.E6oqN*2 ۉ RRhOZ$KQT%%Io${簌duMj$bRTUp$}&Qp-ő<\X1pyE͹Ρc(G9Q^mҮiMR4r.U?޹!qhSI, >As۞JzIprCf#H'S~n>㭩M Q䛤(%Qy:xqؑ 3\T:אuURPMTKmSW7Hƃ/8Uʏ%Qa5>bY;8HhT"$WaiRiIĜcuؐl1΃Qܩ/c nqbCL1' xŃyh'Sbʺ/\I!Ts! xעCc,fbSo]\6J%Ys(Gx>8}ާ?/e$iJG_Ia.?Oh5tqRwVp%jqdL4t899V̈gBV{Ց#:Dasa <,ȎS#խDx DxKKsԝ:L\ٲT6je%GF\Kr#MUV LFq9\prCjrc^z5נc^z(,%غ b-O.>غ b-O.>غ b-O.>غ b-O.>غ b-O.>غ b-O.>M "2OG={Oi~g3_{簌y=y#1=OG={Oi~g3_{簌y=y#1=AS{HRң[8$I{-!1QAa0 @P`qᐠ?!h0ABN_ă(n pݑ?M:̛-~u6Z2ldkF0Uu5555555555555555w]@b|= +cቲׅB,!iǡAAAAe2%`g͖Ye "0H0p@KI1c1c1c`ڛ-xY.ݫ~e|VZt^4/ݰM,@!O NA59,vqAPw9 jW yh=.ssdڰ6 g=Blto@B轾a 3@ \{R /`&,G$Q,P':3 r0x}"2bY xS2vXQR и*t#& gx&^iȆ3 :[@@Me&l`AS>(1HLrNG4 i!$p11[$_C+ âDltq' }5ba& 85)ʈ A1rcgb'[ؙQ3Bb;ް3:, <}E9Z|bAcׅæк!cR(D.,Bfc)ł)݀?LS!c"%*̘%ڼ?MbF1q{ 轾b0 Gg&yԁ9͂ 3BXu"3%7_nj6K(Dc'M&(ım*OՑ$ I@>f9m;8)V"`#Se 5Bx+(w+(+(+(F X SD"Vf[f[f[f[X , >X&^gxIbݎNr;V 0˜9 t7-޷z w.Q0dZj.ۡ䘻q>JZ֯jZ֯jZ֯jZ֯jZ֯jZ֯jZ֯i "<6Z.iP2ap x,R,R,R,R(Ba4ߗeOg&^c9ZVխuk]ZVխuk]ZVխuk]ZVխuk]ZP'B?,b%ܫ-xY#+koV[oV[oV[oV[P^M&"3[ [`[`[`[`RC:L8RL"I,,,,,,,I0:p !l,,,,,, `e 5}̯*_"8$TlfP!g8="7LfFXGT|(9(Oğv<`0DE+-| $1#,pYuɇ,-?d虄,ߪϊ S= %q!fANOSA"Ǘ_C+ â=q/C*eS&, -33ӎDF+JsF Dɖ SG5#eHwftF>/6 tHotSȂv4GE^3EKb%&_و1AqA,VO& ݋(D U<#lx! i :fl(;]F ] !Dp/.}XNW5a&"t̉n,Nx/1(}) >!RXc76y."~::52"Ăbâ9!ų _8$h(p,ƑJHś1B!O,1Śu[34`td!̌BH(Ɉdˆ#3#?Px4 HQA 3"'mur1e`a.1@-sAěA1&L@7^€ɠ ΫlΫlΫl lK!6f4QŌQJLɑ'A`2Aq-4&SedU$ᐔM02B kQ|Уt4I p qULƉ30N8(Y0zg d4 D31B V*Fh3Qsglp>ڛ-xY.~aA׉v %{~dO8DNK̄Wo]N EDHf_zD:轾 t#%4I3.&e#2R"E8P$H$3:rC<g%朐DtH̢Ip6Zx1b= 88889h(T<~Z\/HffoMVoMVoMVoMVS1V! h- h- h- h- h- h- h-*Kjl 1~[B (PB (PB (PB pmM:̛-~u6Z2ldkɲYeγ&_`gb9y`6*#z2? <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<4qO}}n<<<<<<>yJo<}FO/}(U<iP ռ(c 4Wl|fFT|.\yoKoO.=}?~s;w?~s;.O.˦Ux2@P( /ǜ5j2{m>3.v$FNJ/^ǜj@JkphCqJ^j}Qtf]72obp;,9DeפK=` n+iEљtr5I<]:ysλuw$G_INH^H^H^H^H^H^Hy/mFe̺|ޟT]Oꋣ2s҉!iK,a!1QAq 0@Pp?ʩS1^#l&'Ѳz'4bbbbbbbai84(E{W^{W^{W^{ Iƿ7F. 'c$㐜4SA&NXr>HrAS)|0bQ͉Ē a~56O_?[J9ݩK11b\pedqjy\1(",jO$NxJfn ](J(G6lHp3tΙ:gL3tΘה'fy]dۭ6O_xhWWWWWWWW,=ƞV^{W^{W^{W^¶:K s*دb+دb+دb+TٛdnK qNFh$ adqb47́LaAO0/GŸRrA2í'D QȇRW/٩KuLX2yY:\Z6}DGRiMH$xS|!4I(dƿ7Fga+ )Hp\4bJxe2tBIeI(2΢o6SԎD% \.Sҙ] ;f=| YC6B|2yI9"w ]W5q\#_ٛdKLQ(}>rG܌H|Ժ++++++qM56O_ٛd6O_ٛd Z(#-!1AQa 0q@P`ᐠ?3VXo~N:>u*Ê@ W[jbxsz훟ԇlޤ;f!7? ;IM X8pÇ8pÆjy2D6a)ig217?#81Jha4=M?vHvhԖX~%$ɼ<@C.#jH.ʝ I(-p;hsgYLFX@S+!XKk?%dvG|$IVZe..goƻf xӥpUySKԞ9999999999999999 ^KLu4X) ^͆rs1Yvo.oxvôcy)MU E4tM1vEnt-by1¡8 c.|뮺뮺뮺뮺뮺뮺뮺~|F57? s#Rm|rܽ7/y{n^Z]t훟ik]~nӔ>8AUx@4"?]0Rhcy.Js-q_2+6nnAfjZ CHk{Z`B(yEk+) F.+fB.Mm.iwK]6yͥm.iwK]6yͥm.iwK]6yͥm.iwKB%uxCe uAUpZ_Yͥm.iwK]6yͥm.iwK]6yͥm.iwK]6yͥZ{c}sr o\߲O=+x_o1W;+F_;;fe8GֆzbIR̖"_R:[-02qoiÃQ1QZ&s2)'Z)iQwB]4ŇкV,]}Boe-rDiѩ9}=Y9*j)GkKbf lX itgCĴM1p ՋRC !(95ش`:јyɮ Uʎ5`jh_[X0n~Ǥ-76 L)IGBg8D8CT>. DXIyQArR.T/[CԒZ2-^o<%+tCQ"}WYNnޅ ْĶRoYVpW)s,Ă.%6S+FO64,X."FS+AQޣԱRY7QW/M/ *G5,5 %oT3B.SBa[e/J*J`vB\5Vߡ?W_PxjKC*ƪFJNc* XJAGkp Fa-4cr (p25®LZ8%.7w!kUeXjP8#!C?qk4²ᜮ7]=U-VbqM8zJM,9kK^KEqNǤe`Wք82n#\RWvTn,L1b5k %IE jou\n9αfHujYT@p[hj*b Fn uKIzb:At74ǜBx:g~ 4^%[OS3f 'F/[z$j(#8 7l!nKq{GGtp!Bj ͝`#MדT0 $;ĿmtZ5)g]gF5{Zg:{ 1o0srҚT1z*!댬)KʂN0U֊YF̺R7&P"G S(-#e"(ڝmW-m8(ep+б \0W+)VҴ#տ{s=4L@yz6 bZkZ\KUօ/1 Q$YPSyqEVu`}0ۑWXB@n\o\S!%`.tЇ -)/ܣ@?V #.$[)-*O\훟ېZ9"O*U/>/>/>/>/>/>/>/>/>/>/>/>/>/>/)ׅ(5Oa`R9t @^^g~&GdPqlٲRWOr5.j$rhU뚌 ABYtGӧN:tӧN:tӧN:tӧ2{MBsk8l ѱӧN:tӧN:tӧN:tӦ(|[*ٹy$dKRqln׈ފMv }fCny,5_nҺ. Uu`yyyyyTotBr 훟ڐpP"q^x S7 t"J/A]}BoР S^Uk0` 0` 0` 0`җUgٹoeLthuQ]}Bosγ:ϼ>γ:ϼ>γ:ϼ>γ:ϼ>γ:ϼ>γ:ϼ>γ:ϼ>-]sRe~uVw-ir8ҧj5P{HuMZJ2$!yj(\5'Xsa+\b=,EH;ʮ|6(aYzq%PU/B l+W1T hLa f\, z m; Zp] BY*t\fथz3g[k ΤPçz@'FaUZA^"NE8L * N\0܀ŸZ i5qrZk;] ^v-sz xXFƍ2# ETL-lQmj@C^R%N/#Z0G#ЎP[v3CBr#tjklٳfKAp 1>-!eI:X3DEi.%:0EHPULz30(`s)A(*GԬ/E%{¡E*1V3"PN1u 8(,$RbΖġbp[yK=xFxqhc=kAzE j;X,/ !2𸂵qq4GQA?v-szWnrbڮ{0/!˘FKq}ϟEB[ȥ^z3\D|KS%NxEUCzERV#zEmcܡkƲӬL-Ke.qUU #At 5x+͉ #AtmL`T ֆ)Ź%,vs[wo]sRca@"@)b#zqqqqz1]pgDNq1(AKfjիVZn2x5C6y;͡mhwC6y;͡mhwC6y;͡mhwC6y^ 8[.57?Y:ZaB (PB (PB (PBI:MJ-:9knRsz훟ԇlޤ;f!7?ٹHvB\kB œ()Pƙ;4ϕ endstream endobj 77 0 obj <> stream xg@G^ػw {-&4Xbohac.6D""cw\ν{ss<ӗ〞Hf|uU50k>[ʰSc4g*z*Fߏ+Mg$ uJpl zxYϓ':zv,fQ;F`Č! _U$d",m4"X`nçKJv=&W]Gt)~|>cԴyۗ̓,uXTQɹ~S>Ͽ?.+05O뾲l8^[WV,$~ׅT"\$3*P]m1Yj'>bɨ*ɒ]",,,?z' ]WҍEA"^e(C:aŠ|NXQMY{7d;gپ,?~>?ɧF&F]׷c|GyVYaǭda^\3Џ.r~x U\x,(HEuW{8vųLFqϴO\r3Z%Oׯ?X3Ȃg=zzX}ӬҮPE/>'/>۶]ve哪5$j?qʎXn۶ML9k%W>_˂> C+҇T_n6eAw[]>f_5KGѻ$+=}}'.~W'[AGe7XRcf;U/H~->;/L^=ATB\J}0_(y}jScT}>'(kUOg}nOng74fxϿ&4iҸ!ioN I˵qC>Iw\%?x&"NK\}* YEQbwH Vҏ;Kwq)1΄\{/klBwj 5)cϒEx\77BGO.>_v7gkKRpS4>}.3"uĹ몢roV#7e.)찈eniʯK?WQeZS߿Nay݊x\AϽ=G!Q,RȣSJ¶M-Kwc7e \Ŏxm{/ZvCWn>G/# ݚ+I7~ãOR}λt qZ,?+BszhpwJ)@x߼f^]W^M~@kpʎ|zq>_263ߍ%S8ǿ*Ju꽯K^\E8pxݧ¶o j7+ZvL }γjnKZ~/sƥ $U'|<=tAz'q:kjV>d^sftj iy#COid҇2FG_ey?ͤ^Kũ[i۾T#P#|w|+7N.{;w*BOԘ^d!mCC\HK+}~J~"e}S]Oy`*}~rwC\bk2H+U1\i&ˇl% ;>G qkKBnv|#̆L>j[~㷅g?#{ӿi9wCVd&_iϪ]VSKu4!{Lϗ/x= 4*ءX/^n;$(hU?hpPAU3X$!yM\|1jwG>'/e}zQ4)hOO:-·׋J9Mͨ4eCXk'ЍՆU#=˾OpKsك+}:}|-~8sץY}7ϙ˛/Wq ʟ\}l Q>/fYq>ha ?ٽud,`k1nVŎVJ%lIeۼNV^Y>E%Ԩ_fmh;N=l'[~z`5Jywg Θp[z73n'ѧzPƅrik+cXm2NHS)۱_qRq?RDs˅c3Ǹڏd>xJ7:9 y7S8Ivtj9S![i3i鸔i%?!nilcˇcs |+64`}H*[U|[Z6$n.?G#?@fqS is (%-dy2ԣW 0.=VaҨ#z}lM7F ٱBG%x; ͚h#fCErh:눮erLJfɽ-{;+Q#QaILoٽy8=7KwŎ,mOQלǶxYkӏbg^ka~uɨZ~/v*vZF?fEx'K_0;~˾h>'3|sEz{Y5|NXGW䑥ܾ>Sҥ>2E+4`/!ӸrRhzV_=ЫX4T|h |j'iF3 t<ыؕRE蚙Yeٯz>jI$rε-ϰfMJW,ezq2gJ{ηQz/(|~wwㇵ+y?67 㖑?5!ZۉMR#v%>?A+%6ÔUu?bIk|~?=)^>=Fzg/heJ }ұ ϲRgɃEٙ8yq5zqW)RXzx{K hW~Yڎ_>Du͚)W_ 4+9bu$~&i>p\ tqC:ubܓtac>gZGdя\fGlg1a-љLJiCPmd k(ש}NXA .82HV nU/\wv׾tlne ͫV8oj^ W^j-䝩vg_j?aQ3+{WT\R[Ȫ'>sѽ0^ә~N viG}AYk{>nom}>Qn,>'62%F>%4]\ .}NQ"G<я蝴b^2?lRkV>]N ԬBOB|Ʊ)VڱIH ҏ{l̎` ωԣob*kV_/.m9lcl >Ǫs-TP|ɛ"FZڬI|y8%lVT+H Ć{ǥ*OSB紓44\* tuEũp |냖ю>\cCk*ML{|\s,vrY7(dBwetD/0lk>_dЕΩȎ8 + 6S:_$|ч^#{R/߯"{ҎعKx$7k;+^n49>jɅΊQm^5GE|:x; >0-հx'm*d* QRV=Km6iW\WvڵW,̦IJwGVg%u|\s/GނO?LZ[G[v>qD>o7h:>,ooş{tu[Ŧ<==;V0×V,H!6_z gCUӢ % giBV,߾3wMe<Kg`495Б#Gl[TfsXSnjY#v&{Vc tN#UW~SȑzK|g鬎ͬt=W5>sokW`Evu]ψhȳn#QίEzѳ޳A ModO"U`r3g訫q܍!ӏx4 weA|}~|d_9~QVգ\sAF_(ga~J|GKAUR;V]! ϲ!ttpK\Z*Qث#rkL-zC|>`C[f MUOYu!iihب|JRk*5Xܰ>5 3O*]LhkeUHL<ҷ]`_ 'JwxƆ9/1Bc%-`-gC/yاz` 6a aEUUuKTypSځv{'n=eQ,W/Q,Umr~V7kYJ.;O*e'h~y5rw.mvu ِyt[:B(\>XEo] -q~su#֡ پfn>2*4ٙA弽 iS?=e$hȎ }э)yyM渄~e;|-{.4Iv z{w?hC|}>c^o_<O-)[sݞ(m;{ݘnԦ4qGehF }F7%-7DEҭtn7Qn}5,KpzDhh؝.nN.j?=JzFsc3[Ҫn$/4[IK|0&)rWBC{XGJ) .:c\a^DŽ$`;(j=e"gp?445#/n!&FqGLktߋ2_m`* d$F &SioKnS#5?yvW:k3vZgD!օg,R0iE?t& )|)Jd->[:eC,"x>Y> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> 3> s +bx kƌ>'9n aL [aT3Q_/5bcNR*&g& pTmT2=8!H1UMP,LrQpD Ŝ>W3A= w\NR g`egʀ&M@0lLR?P>P>gQ_3^T& ϒ55]P>MrL!(Z3zs}7|,Z3ٌgw.ިsOԚ>MXB[P>7aXEs[>7R Ϩd>>|6'6T碼ڥpް\ >yIs""2WFs\|6lNlLa@iոhQɀ\ؔwZ+Gc\gq)jq " Θdg`.lއL:qJ|Œ>Tٌ9&ʘ Yw}p9z#OB*v_91EDl-D٭h]qlٜsz$=-IXe߿Q9D|4|6lNiGujߴgqq<'&܁_ァ\/>|6'zc.aϧ;Tj|6lNY.S > =o듬؜imJlٜ1@=ۭ}t!>|NV;aQ[]>a|+':>1>kƶ}vO@0Cyx٣8>[ ~B(o}_Re8XJ^ 26|;6gۺϤ8T̓>=Z`-vT|tTǦ|.+!n}Ϧ |~;"9.q!߲prV uؔOtE& >ǟƊ^cou$uϩan3Ϳ4¦|%;TX/)eݖL~ $z6rCcS>w%F{}NՇ/LWSn}ZޓA")xW-A|/Vpe`È};؄TBښ\t|~۳xCiϏe|JJ.S|2nBU_FFaZyq=1)IFy},D? 0?e߄%hE>mRR&}WZ|Syc;73 mg.eo'WB;"1 x1Ŷ sMՙ6ˣQ90V殳Pb-AK6s2.Z"Ʈi>sgߤ(-m0@ 9~vTe=-u^7|ӅfI+ wڮ\_`*`qμuB'l ,ckf0lgJ?$1;ۭ31\µ Ǖزwf[عX A>_ق}IEm2 qMmRsZ)6 9ؗFJ[sƇV|Ž̽^^֞_Dd+\DPv8%r(M[W΄<ƣj9b38 י^Pe.VY,/Zv~On6'ܟSl9T/poi9V8|[+*rƢ3밚sI5O4ᦥ򩒭1entFllFSQ3 m>%_QnTaT!,~Z׽٠;[|]OV rb_q\2m>Z=89Y Gysi޲tB>AZMs.DK 5K'CϼӭWF[:}&9VCn~vʌv?̆|=цg\`m`1,digwm`Aⶰ׊ :c|Rh%K :r@hm'|[aq L};#;) hf,8삥5x!:{_sq[%֯D9}Ng+bG8ޛTlV)`FS4yN $1\}! !aEBrA:yZ^sv9+.g pT*,y?|s sr4*C po7j e[ayNoy,Sv_?5&"'貳KZ Ɓf悺Κ>W3< w\дc0I*Jt>u)``e~|$є>{ڇKNA&MzY55g=9!8{'kh-Ԗ_[[F:isYsr{J zdWѩ}KNJ8MEvQPDsz )W`).y~qoNn)#yzĪ<>`>U[-0eT uD~VɄc%7/O%SZd ߤqI+)wO%GwTIs54{E#ρ5qJIflEo˝H/ qW~AJf-6 TT5h7:DU-zAGg$޲Z¤ބiQA EfL9:C5*idkWNB=%|֛4{Je.|6}Wy-s9G6>'^ngUG*ބudqTuY1>>'pr-,t9V%1갳?Pބu#0r" xݶj\ι |8ؗ-@mT )t>;ɢӼL?g$> ݳbfEXV{[YC{]ƕLCI;5-3n$|6'MخV)OKJN6KymEզXρLagq՞~2pM'=Ċ*%pGɷep>/$>P9| 6u5*;g!HӥFg9~W v5L0%i9p7>Ȗmij1g8O~d9tL9Vs|M/-qvEk )ϟA^Yςq|~e.39 C \xZb)[9. 1*Y0l(6իϩ~F~c.j &..> "(R9paZYP?z܃φcϒ+ےMvhBn$=-555999Q-97=gh5AƇ9\x[Ɠ >_;Gg.WuF`i;;w[b3>Gy=_ż@HsVNF`4Go ؈)a%gS Q祖]{ےI|ݩ}ՊвRO R}ӆG-𩙌i>itZK|6S|Vh{Y |Dmo6 +i58]2O"ʕ+y!N]|sۥ0Z8m|o[!L_ө`ϥg$gzUW_7fPRSRRoo ׂ-vvvޕ7h'?߻KO{e/Ú˷g#i?m*z? 8KaǷlؼzք ?ޭgZիW̝Ghre=;\rwk`>ڵXv}[B%".nR >2}E hݷd@Q-+?EjٰgbY@\|{/b[lr{ 7l֪5|4], 43|| GO`gigg[A~ݜw1nki6b]'T«ח *-pę3n8tЩ.]4**&)%EK[>?=>k}.?}L﮶ܶOj q)`ڙ[W*>(ǦF%ݦ}n_COsns-w"9[b/Bn)m&\,XrvS mqcKuBFgxTZu)_kR{Ml0BnyxqG<_=>@~n0[i,|Ϟ7^ ώincG6D,owu]"lwƷhi8-|֏hUk/y~fS6ӧ_"ls;۱^xg#y )o_eX|6[}uIcWv˟k 8Wkl,3qP "y7+jXlg \x6VƐU˰wX>я>w[[>Vb bN+DI?85o>ᳱZ-weF_ևI&INq%(Rnlh >?%4=1t&R[2 6'xω%w|`$GVVQ:kҷ͠4ϒ'Z _CI 7 "ō#kkY^dh6u)vl%8?̉_,$\6>O'~JbE\eN }x|6PzŽ.೾dd_\ٯ_-X>!vnr̙xfϘ|֓i_/WbVSg{sj|YWhl ng=x4(S\5)$q.=4U 丛/ltUXBgc-i jG.Z=m#8%Ԛ`!T S`_UIS^\w *~)鑣YIJt4};Ds0}E-w"9n9.$cёKZHwKP832' 8ROP6u}|>;u7)6W-ADČ?7'd^&煹"0 3ؕ8hX7&:>+$c]sYykmcJj鐇x 8p6??1^CL ,+'…Sy8͙ɿ'nC]F0Iv͗ޣ ݑ[='A꩎N Z6A |lIUj\Kn[>O ӹlTu\f*Z}a #v [dݻ:|.a RXb|h{`~bskDm>;Uxi!-YLH/ەssYwPqW%wlk qq K_?>^ZFןB06[,OЎYɦ9mįNui亜#[:gNǧD=Z}(t#4pQ:b|<ޖI(1[f+μ)B3\,r'@=B /z{WD| jZ2F/tB>1tϯ8z .:\$L/TNȧ>%c)JڍB*L^tٴW"^ߓ_> H F "O,A߸S"Hgt}x=,{}*jk.t?}}n |9]!BZ`F`zCǖ1["TqibaQ;oQ=n/moҥ'-Yx Wt6XԎUI,t[ϓMTa ZwM-> M^P9b7^zFfy4CfY`:Q UFbzIacJ8bwv(^qrY`4s!,Oc~vxd>sDzN,m˧ga9܄^#-Oӿ+t;֝xNN}tur,$7'`&. ~+?59}"\..՝Yw)֌/gɋmkO603MlgϽQ#Ba&eōUrGCJFVo}6(9\K.iSs~Lx3qn!gC@S<"|v7)+qVѻŪIF%S9O1Qo0}tGzGtAaw{x /ݴ>H2.@f|iۅz4c%.jDgHޤJ_L>udqY},tҬN|~>$nf`=;6Ԟ=6ѐ CojM}1ո rvQsAN 0ϏY}éE6}%@OLsʱ#Nx;5z;_m}>O3R]Ty 7{ߨdgu}6b>=!.߀?b<ݤKuYscS9.Bgȼ1 6 o_ I5,xy?KOb>_L.c *G; y$Z~[> >ϒM4@@>jY{%2w%χPxFs@Z|G#\78Ŋ)lJԢK{aҟ"l[e 1g#P"XqP% BY^V4!s6[|d>'Ljo Aęͫw93s4|>:7ً' P>E\x$9͛:[Nyr4|xO(LCC+F"`o%{}Ses6>[߹xV0 klFэ>7ݦ}qwF L>mgVnwp쓩#ۦ|yD8G }|^):*Ӏ(!2 30|63K]k0+\jS>t:! gxrH1fsz<63)lw:f>E&%_=El|6ɩ&'gcEts l at.|~a[>kzlZ:1[$'@g9/~+˅g `n4-?3l 7xb'@ ು\nJ^-| 丳POgz`g9w a`g9&lfs|6+`9Qt3I vg JfL'(8 Üo`x Œ>3U1s2}4j'g f| >[|3lH:R|6# R|6# ȘꑳNY1Vm(5pu\k[a)K_lQԏB*7'e3bq)>f E;>Wk %yW=/)LrtX:a2!Q U ^03[i`!M8*nNH2sB:٧2Ody\u:eSR魹S !' fqքO7R>`q9S#){ XICW+o<$ֺKFEacwFI]9F0'ʶ?'v!t#cau2.:K/kxI{o6x8K%\]S|e.K/ӥO, 9;wsMN%9XTbR R~Zivޑ}KI|VHH[{Rw8atOnB0cw k@+.m;11|NN>l7)?mdg|~VtrAB}ݝoZKWD1wsdZ:?XlئMΤ@8#\Pˮх_ڄع)mO/gm^=S?"vr+Ҁه{ExR@'VXBYCzkaKOM<юqі;YvεSu8[xsNn|ŶwBkZ>Oݖ;ak8J}^K]rp΂`>+)>\d{dGr[ix:|S^ϟbm^ie=>7X-OBۯ$e2Qs) )~nq#RCcis"q9Be_XB</tY ,4A*Hsuf8&)=4&{=>KwTZsʲ)`7|u"$(21ݩr>h']5NY|cόvo~$-|/+!5d%\|"!ˤ? ̥>3_ws QO'i^>AI+9)c>_\3ݵ=OH%9uI.[ 5a]+KT;)\)9yo؅@0aBFds?ՈGGRQi{ =7и{xpx|!NX!gGWxOgDoB]{<Wg{;G;)k>{vqqNrAUy'iU}IH_Т8R׀҄}HK GY#eW:~{5OKvn@WԨR>IlyB!\7/iAjB 'υv| 9W%:!GebhR߸ǟɺX1)lҤI%!Q2f endstream endobj 78 0 obj 17385 endobj 80 0 obj <> stream x\MݶWh/7 xγv@EWmR[$sK:I]u$qH3s96۟}K}j{ x*{OI_8?}k)ﭔl P'v@x䧾4{\^$. ]K'@qJ뵭u,8,&Xa %j1Aϧ"7~&Xa#/Y9㵼ib,i|9_\s`%u˘M bj*$Mۉ&;FK9e69&y#UJZX_AAk(k:Dia"|W}@*A6K.3Z@yP:=X7I} n, 76\0 Tu+A17S`nڈV~+n.-hP$XT $mO"@"^hҲF;l|MChUHZBd%G8(*($iCnu@ּ[ /\'Q*Ȑ =ΣBw(2@"vQs8ڨUm;Xhjh\kQ`2qQSP$iQTš ukqT$;0+Eq6MV!JѲΖ=5R>oɃ'z鼬vYٕwAaҦpM(SqJF\ڸT'I.}|burd씦]8g}KxNOf]2zXڞ^o>QЗvܥOo{aWQ=H"˸lwܝjzjT MUkP8.PQH510dI"tB֚BȰB"K T8}J3Ha$[͇FYa{d5M#͒))cz[Ȇ 9t^`lu!ZhxҙhpS3r//Y88 :3Qnsa=0rJ9ׅ9vsq GUŷiwث|bʝoXup&\@8VD+mTnŃ,s_gtz|n`Z D^XA@p\ulkUtm\gYm!oL-*#ߕe43zTx:J9KzsRǹEoOtV\0;.3H5@T"u9k݅1+B+WM&֍%Bf0EH2@݅K \A7翋XM0%"7? |UFA%~ԐI%ËT>^C.M%i.Chk E5$i#brN X?TJQLM^MI5.)uoW[\+nP/ Ul\CyB@r׫2Z$l_}9,KTX{#=aP:dTm"*א(qٴE`v~{ٟ ,n6.=zP=P5w @yO P ~ I f`$fal~Yi)'e_xJx@VĊb%p:)A J2ĦfP4< *]mUܥyVj/8 ]Tz?Nz()Qd\?19kŃdY9?6VT`8vt$&lgQIhҐu)| S4 \hlgAjBrPYDO^tTFR9HD u.d:Vɚy~%9t] XQeF[1A6yI^RDe=!JpAv0H*WTK SRQ#%8;d@5 5}L0itV8xa..tw+0n;__Ըxd5 yX'Tbʥ8Q+v:}w >o9@\\_kּ>@b=qe?|+.K$^zojyHIR5?(\F^+^Z Y>Zf(֢rsu^*k"A'SZ6ä^x,jnXGC}4S]5-d謋GQZʬ^nU,C6?iI:ۈxm/ wiO*OۿPO?=1_OKC_w^b(!t8^z|zr@a o)q<=>ǷG%.OCǹ ]s8 f\D7:O1?)o"u;it8^)70'+Lpݘ8&h 98Ptzhx~E_&peD1.vb7T~q<\.=(ָW,=/ZWSpX-N'˵d_YinҥTalz):쾪ce^A!etkn{ OCՓy:#=!@p8-e`IoBJ}ǵW5[&zշuP|^MY,IytN^TfJ6;GߞVq-NX]3^}1kՖ{7'[Fq%쎊+gwP?(#xT 8w_W SeTV!af8oM;,<_C: h[L~4gM{98D)xbnan0SdM I}ؖ޻pT81`.Oj uX @4}l1m{6 Z}W/{!\4mሴG[XU{ GQ?&',*ꟿR:Hc|lsA 8$ ]K: e.{93 <VHYTXMW8]ZKG߉AO̺Nk[$E 4lS9=~Ec3ׂA ';7Uyq_=4C3_lK9?  endstream endobj 81 0 obj 4715 endobj 82 0 obj <> stream JFIFC     C   Y"  3* * *J߄] ZW GHǮ2 3`aN4r;#otںtwUҌ~m;^^UR<3= z*Hu"ԈGR!Hu"gqM76FM5RWKN{ŋM9-8ݵ|it]3ߋ<ںv/$2^yG$2 ;}ɇ`)_1 uZ=YAz6ީԪ` *)C;cn=Nג5fFx`u_u]׷^ 6VT=/ tn=} o6&^,VR趐GFCStx)EٶZ~%g)B:̸LvF ~ 03qF[9g^7Srԛd_CLU퇓_[Y_Zh$J-Ϗ^+yϠ[essnM*Ue]bfh`f &>bѳ]ƬJuͶe=mQߦ3w5>U}T>U}T>U}T>R;UobR.9NίOÙ,){g[~_Az.،Vj-zJQ0-1 ϒ"qnz}a64zRWs^?X_Ņa|X_9oY)ɣR\38dg瞧L\ASN:unoInX}jm@8{5瞎pl먦 FCl겊ꊊ+0vR8#~2&F~?mˁJ\bԎ76kwqJ> /0TASN2mރO|N -,/ -p®;lzRW?np[\mpkczE}9B}7g$ q ifÉʴz;{']wn;Roٓ_kvxnc^u+ 9&ONcjQmFsitccfTI\RVSDZkÏ7<*)m5Ce7Wk9m7FqBlOH | )Ӣ*Yz=^%`ӛpncgۇmŶJndFIb\i주1DE#2~kMMztoݡoh[йWK̡-5[_3sy\f/VN7oq}=`q|v _k1I>wbeA ͓_Nu:]8d>N߲Km|:)+JE!K5òxj;2Iz]Wyzo97Фi7BA9%>=t'6{?V!eϞ>o-ÌDzz*.v/ҩ8q1Qzv?k.N]vG=yͧE8l'6>cV.V]Z9$S:3OIe>4 FƏC񽍆!]'3iΜn.胤z/ܴi>?OyrSwFZls:7R|ð/ZNW3Zh+, +\b?=RWuo)LDKM,4DsVuܝ&b]mtV/ՒU8zOZvlX ɥ0?Sb܃g=Kp 'x৪R'^$(#=f-?~fMY$4Siөd飙:hN9d飆 a+ME%qIY& ϥL&g\WD~ )EܫIbҌ:{TfGڢI6&'! ~m;9}vW=QJI4F1UGu-)4x]c5㼣r|z=<=vGy|1e+TH$Q^/6<.}#{OF.F=wtI\RVr mͮ ߢ}]Y^ϠLEm)L@rN1Pȋw9>{e(oN\ue9O@Y{)wƼ4>;gJ{!z@8zsogbhI7p)`sJ.-tz)K>X P9ϱgA&<7Dw)l*V@(x=2X%2X%2X%bRW^#vgMMnl&, +ϿBu}NQg[#B4r^ׇ!5s˭͡>cm(8EbeNARa Jhz O~W$vC.:Yb>A7RW:K~AwUg=o'H;5gϺ$y"_GCi79{ M}o:Oqe M!=Bz9gX{_I\RVrzu(:ۏUj`sg?tٹ~ Ȝ] |G^YCvܭQ׷PU@(W()QAMDӁN(A8Aͼ/6O_,u~A=>@u֔KiŨ?^|O'gS|}Q%FOvIߧ册^q z8يV=TZNj#H:3o[v=oWE%qIYEE)yz^yz^qmO:hQ/)=܈n-뺜[X"r+nu=/o=OJs֐qgPkRJ[mrN\/t߾fh=zR!s_m=ɔ>򏙏<|c|Dw"?Uy$Ŀo4W9Y:i\fM} >(7f<نllsqx;}F-%`-G!U*Zew|a u(̌Ra-٩t%+禙~\ha(IcuNGbmᲷ1mcEVW+Ֆ1l{iGW2ix$z8;8<#;vjW|RW<\k3\vm=&Ǿ^G=2NaSlY/sl\fsԱ -#S#%ImF<.V]mumCr7 Syy王Xs{-#59 lɻEzŪ*(*(@IZ(%hV Z(%hV Z(%hV Z(%hV Z(%4$o,j|ɱfݼz>12βڝsnwmCoDiۧ-5ݥS_|M9̌u]msO6I;Jj荥uDmG[˚\̊f(Dʫ&V Z(%hV Z(%hV Z)6k˰>WTPUAUT4 !016"45@P$%2`&7AÒS]JUBssQcQBU+K[=JV Ubcu.QbՋU)yKWlOo)2Op=H#p=H#p=H#Ffdm5[˕/TqG4q4%fռ7Fwd ŋ-T5#_#s~9G?H#s>V]pP0(Ƕ֦5MjkSZ֦5K!YyO֥ח^QI(|ikT6нjQ/uc/i"l\b \RߗGe D֦5MjkSZ֦5Iu0U!_X= 92s;띱ZJ!:]}MϑCCCC17EMke|2e(~r(~r(~r(~_NǽŇkRXb%j5zz|Zy8l$sYU%(R;trPPPPo8-5z(eJ6&g l[ [\J|{FhHG#"iU^jYyKO$G'':Vڬ@mے$;nHvܐ!rBa?2ե=sRL&2nFMJ*Xm:E#ya/GMTݡfEēHDm5jHt66idKmҖ7-ybVim6Mim3hɷ**q%5eݺ2̲\fHv?yd|Lg: SQKLt~Ȕz ~ŷ/MDzM.g('>xg[?ŏ)rQOCCCCCCCCCCCCCG)co_axN`;i#NvӰF4IXWX8,HK4*Vh/f $z3j@:gr\zh1^KB#ϰeք8Nw*IR TZ eNim;mmӶvNim;mm|UTΉ:4:4:4:4:4:4:4:4:4:%)oc4rm*Ԡz̬y e墱p׷*P 8T1 pcC*PŸd=RF,pbQ ^Y]JN닖=APz=APQr5)_[j ^(ȷmΖym1jFɵf;~ ejd,",eV!xŵ)isGO 9[,wcKX~;ߥ,wcK 3$}J+j'v!~  qIwE$2)aͲ ~,zF_DF m$nJ-j]7NYJ|kH)cُVN͌?[D{-[CܦZUTvxҞ$[Cܶ"r_8N>܊M}YH'ΓbCYaR9vMڭa(Z%͢[p1xoѪ-Pm)o r߷'uh^ye/i%)F|x7%n6Pb_dLn; s#*kY 7Z?C*} b##lNIF;*ǻj+j?2vg-_q AAA" B6=uO hq^ؗH߮|,U*ʒK{d<8p3m6Mim6M-៱n[*4êZX|9>%^xw#v68KI w>zr.ny$aH|a>B͌A7K(DEJHimFlնlѵgH]N5+TkE5q'YDq-W,Rm9J|n[o7yo7[RQAeWmZh[noj5[UBD4mbڢ- hJƨW'pxwpzwpzwpzwpzwpz0bQÙ][#"tVI>2000ʉ<̗CCCCCCCCCCCCBYL[OnU+RY] Ytn'sFԓiešZ 8IuԲddm^Hd@y8F19F!VSr7Q%uRښm ' O RbڹoNզ,NM_itl}GCB1 ֢imURʝYS*ueNՕ:VTz%op$CJkK-uxcҞcd"$=c] :,R^q B?7;)G9l;Ey!aksXC氇59!ai3"[I8걵!&V*uͳWz6O#4jr%oFAs) I5QFkw;Ximmm)m6MiK OM)A;i3O"*VHM qX%q篜6ja*=AmiPa{Ȉ4%*roqSK'l.7qn(qG8Q#obC[#phՕ*-}UGTdu.̓~ikp:{ޔ?{'DY":Y_ˑn_NSu :::::::::::)yKOckCĿEhhhhhhhRD]''-)pJ_&EhA>n?y~.Rǝ3+.и1zsy \C$tIT ~`-d~v<]̜XD}Å.0q 8\apÅ.0qqx әam~ Oc}c6uOkDSs• ~Y4-m2f¥ "kZzdmoU.pۜWO- .,h2FQ;,k&<>jJbΡE֭ |%K1ߓ$K>5?444( [-RlR }kFJy [d3*7 w# 0) cǸ-p[=l{!HdGE-ѸPqAU=.@m~~'Ciœ.p 8\)N pSœ:УLj-j`(9P!ٽo V} YH6j)KrHӓ,g'9R]O_$ʳYSe"JŸ|Utmv|儝iZ]Ln6Mim6MҖط-ybrLFbfMKԱb5)yKL>a{vaf&W1,3Z<_efG%/Xڥ5m$LJťN-*qySJfLRg8(+jwSb^K_\t|;%Rwd]~W/MgvMim6MiK~xg[?ſRj)`D]XIfJ$,Xm.'bynv;7E8-+'Je.Tɧ#d ԛImVgؔmȼUBZ;§ Gdz$O7d$o%g.U=FeA5TccW9To.///ʕŞXVP̥#ew\8)bu7o+y[\zڍYW'D]Z6!gmn"&_Fa6 1_4444444444444)Oo,OoԾKY YsWQi)bIrŋTfq9!v!6U3]$؏ [^Wζ <)KfV&FLxTV9,]T-px[(yLt߉Lx0vybe&dT-|C2^;T1X.jo1X8|&|E2$317Ba,R򷕼NԄ+"VNp_LcSP8)CP8)B&*Ȕ<\eLZ!}M7oi}M&R1|r)h]azb!uepƭ$PƢɢQXޠtlD{deFMI/#IQoc֏kK)e،ke"WJDUQ[}JEn㙿j.I:Ms8w &G1Ndij]ʶ`fʹjJ0Y)cGPRRJ*Y{)]]_A ! 1QR"2Aa0@3Bbq%CcP#S`?WR֫q+q+q+q+q+q!Q'=9{G;E]dI]&z8SSMN%58T8]G(NN% 8’*Ji>Si;UJ<)ȦaIRT%43JaNyMuB>ߒZEh۲X*yU}ܚ/r ٯ ؋]OjkAӮVs0uT"ƻhV`0 Fc-z݃DJJ)Se ݥ02fETm!9V2iiB:JJJhj}sd 7/ǗEM梦QSxy|Վ&^})S ( k91mLjw1ڟF3jkÓ] ǗEM梦QSxy|TmjwL-)Zj[֚ioXa9ik MCh+C,eFT-sS5خ~s\W?zQyNrc`krNKm>vcp\ɕK^Td g?'^ƳV2{Z 桊вetp]8pzzU~X>#Մ sAXcfUdМnq:T)yFV7rѷrѷrѷr-|MZS^L M?*z+_^$r~D"PRJ%I``hUڏ? o(x|D]b)UKw3J[0rA*q)U'*}( SwWf*@LgPB B{Sj!= Qm1΂<´4V Z|(47!HVF{jV櫂++ڴލfDW XlRi9b Q XZ5Z"Ehѕ+DVnBхbXV+G9R!1Q "23@A#0abqBPS`?vPbWjYV|lQ4՘VbY5f,<՘VbX| &ĝ$MZSp+ `ܝ蓛[eY5f,<՘VbY5f,<Ա46:&Pԟ$]D7UQ͔mZwү޴wW8lNձEy9: h'1G%iFyү޴w{M:{*@HQn_hJԧ00*wGӡ_UT[+VWޯ?f1{kO #>$ퟒЉm|qqcMs&T'6<M 6Nٛ#ҞeT$svxv##ҌUUN;gO' IdYpU U U U U U Whb8֩ }*4U+MS֥ D3G7aL+Uͧ˼iTx}ԱͶx`7d2;5Si2ZL.%ˉi2Y,Fu;O͔eZd9&Ii`Y<`j)L:{*4U]i PblK:gEW#yOyh80Z*?ae}{(ЪHОoX,cVj>j ޞ jڟ+掾pn(fPZY4F,)x'C%(rr®%ܲXlmzڈYTR9WSUm*SʺHb7oLwNLhk*[nEj[n楉51R:ӫҝsKQ4թh=ᴀgFڢU`ƈE,UZ5j<<ըVZ5j<<,AyU EjTjF:yUNl+q Qk۴%Q؏S첟/SFhFxw+2UK lVs3a0Svz^/_m{U'uȰh+EEݷ5m98x|=](uQUUUUCw45ڢЎ>KB8-@OY,<%?+*oZ!ڑ ۩Elh- y9J`5Wޯ_^zێh^(8@nMV[5n<ոsOвAiM_.P|4r{e)w*iS?JPHe<쪘hin/uحCHnTޞ(doi`ڌu<)ߛ#S쪪TrQ>;} i)ֲ&t{[Pg\χ5s>k'a&sLөaж#_?&Zӡbtn *+PUA5)E'=lgdq."UW).5qzlVXQɛF'%a˷+.ܬr÷!ϒ;nOM0vdЭ7rnV6dN_V$WyW_+ூW˸5U2+jڶj'T  !125 "34AQt#0Baq@PRs$DSbrC6`c%Td?U)z當kT 9lz? [.MyTq*gԵREsװh"*[«QD6Ad) 1Rs/HLTO3D#,i|u O2qFXc,e2Xc,r54m9(V˹? زA67)b]s# ~YrsiMÓrEגVv>xI)1eUah+Y1v^b@̖%At}F_z#CވDhu4: RRps ykμ}T)IЀ[b^ Cu2cG]n$T(T(F_z#CވDhu4:}iw1UТwQt90򮶁[H#$%R 9\0eK TmxAϲΛ/(Co#1b;\ln6,~;U.gݯ,mZn\)<(AIΉ)Ë1mxtĺEhm徥!* V c`\n,;6ݷ]m)'K6NҨy*gleNݘCZDa8怵$ƥL+_,myʖr%(+ɰTe& ,Nd+an*AyXT9vlo? I>% RkIgǔ}$|7 #40/s+vW0HF` ?Nh/D)e\VBK͠S,J4lД})\JӚQ&{rZdl&p8&9p49ſF!"D*d>!-P L :q]k*R\IJ3qfqWJBV_-C{ĘB] ;/Uڊ{:㩮,)=K͍ōY5Kٶx$"iжk&dһpb&,WP"hPrS/-KJU Bb0%S3.m1!Cp&4rJn sD( _Fb1D2jY-mg b4ILuƒc4q$\i&:I1ILuPEz9FmUleo=IZJ7֣Ӌbgވ K#/|"S6/Y!62AJuU*#iHS-)M1sżpjv{ N"i"^^ǁJBNj6,o? OLxZl=T lX=Ofl C [hiqQƚGkiqQƚGk2%H}ܩ HR(A5gGR=./<ÍT(z%2fe"@&*򘛐`[Śq: ꌃ2: ꌃ2: ꂕ!*IAbbE.Q„;7*f04*ť[7wƐS.t)XKr2[LyF8x?I5JDW0TGkiqQƚGkiqQƚEuQ[ٸ lIN_jRi9!+U4NA.=*ӎRjcX,vq;8E"`Gc#HB$rn՜m2A.#}/za_ۚ1.Wz[xe@8vq Z9(CձcDNJ*`}ay Wv\yĴʥ @y&t`+{1F)$,:¡_q`zmC-\&7JRTDGc#X,vq;8E"`Gc!.7(aA7R7xa UZSӿ\ln6xU&2{`YޓcgYc~ZGj9jsժ8TqV㟖Q?-Z~ZGj9jsժ.-FF? mZ]-V@nqzE{ 8NdqQkz9Rwf<"=*,Ҏ13zӺPlҡ L^i{e7jӜ+􆭛!7 UL6]IuQsժ8TqV㟖Q?-Z~ZGj9jsժ8TqV㟖P;±96# KܪGsct6~ACs#OdGȎ ={"84Dpi#OdGȌ~Pqϕtoo"ѹ 9t)Yck:)\V]!_S 2, @DʤM'~u٥̸a'(,jiMJ:Ҙz=D~~qs/`pE%4,Y։ZJny2Cu"(rl:Ҕ&~QKʠ1@jm1I\;} IEKI'8v#Ob8#Ob8#Ob8#Ob8#Ob8#Ob(Ad }Ry'!I̢)6i63W*&9TR}MuU?\WT{f_]Ruщ7 p&o LMOk7T;{1#&H#$d V#)<3h-;*VphbH?ׯ@ZO!fЫUct6~ARyƖ(RaNyA82 ]FF?P!,KD o. `AIr)ikҗkb=/\q?^q5zj'OW8\q?^p$xYAz56B.o?T }VprF]01ҙ!q2UsbjXZK-dzrݕf*a 2bWy*Fg/poW*Хس։p/4x#A?O4x#A?O4x#A?LNH]o^lꢥ^D~``<К2\ 7h i)UQ,"jYWzq++T85˂[R&`2̃S xm]<|$騟H2ȡI8K9X6L]BTJh KYj=767CgTdH;1غHu#<wXI7GWb]cKa7E" `ÇffK˫ IiHTn^HTaMn|&HӳzNLw-91ܷ4rިӓzNLw-91ܷ4rިӓzNLw-91ܷ3mLVRw.!ESJŻq:8upî3\gq7Qt92jy94 3ȕyE,ed8D} %*letHmfWpIs㹱? ^[Հa $bHu8RWܵ$ҴF#HZdR14ilzQ 7FSQsyĴ7vXr_n x[Ưݺc(ofʚ4xu!in Iu1jC+ZIR}WhbF31ьvf+c1]vyxQ$T!ԩT-ԖHa8BVȨ*oвGTYӒ8 {R-?xUK,U9$-^M%ώl=KĜ&]M{q.9eɩjeJ- f%&ĪEbMho|R4sJW%+Œ1};ۡNOc4>ήe9M@VD>Oj6&˸e$ꃯʀ ?H^^Lt.[b$$oK ba-99ƫ2SG. cUr @q%Ro$83>g8Ԛ$]@iӎ=3JDFQPZhooooqw[SG֤qgqGq7q7q7-(.D.iV h8gTi>-M Y$!O"ɳ!0k*Q0Ï>]!>i<ǔ}$|7 HRd*GIð PA"ip*Mkt1@*ރ16H~bNXe Š 50ZIJ U=\ln>X1*eJZHBNP7d&]S' '|!WϧÔFlψT PB76Y"k I"]*b9+ܤ8xWe,$U)^3cj"i/S|jͫzNQU?ŤKS y22C{DZCf+&[m5SN͸DźߨJD&aAS(iI L>ɴ-MSMUĽo*AIfHUivu-*׍B(\oSs$LҾ 尅8~pn87{ 8Zcr*;q{Lpn87{ q:Ӓ%a7&<6ݒ^PyYycbReDHIJsC+PNĜQ@uE7$q{C85\+~0pM (n6SSӿ\ln>+Z Isԥ}^sԁ.RmWʃ#5T8㗛h5|#Hzknp16U{2B-}s,drfKH# nΕz}LiNn͗*Ɣؼ ۗhTe7feXɠG"ir?6rl%]M]VQv턽2T\gq3#`H|"ƳP4ؼ@rY=DYN1efSHaYFL6("ڗۓbMJ QG6/7žu-Lzזwmʤl+sh]Pe幠R\1uFAazq-i˱1;'4[Ф9!}Sg C\K '.B҄Q3t"IL^:i눺HKNW1` WAşne[ 6u VQ͕ۺ8M(R4|v#Gwb4|v#Gwb4|v#Gwb4|v!O!Jy"yTN|سz;b.pKabRx}l[-%ʧT˃_W{I+ 3Qsq"BЃC6Ahc elTPsWhy+lM̲S! 䩀ݠ?o$prQDH;}(2:(댣2:(댣2:(댻 )zXlI1DBHs6$E@! S24|b4|b4|b4|b4|b4|b8b8ftI-bܙiE m X661K͜فgoZe9+G{<[՗NGgLiyʀ9_v1v/\E2j9_lN:R7C&C T$! (,P㫚D9Rmwv26[z=+695}ɣ8p;̥c#E 7*fCO*rqtJ`6-/0,S6@Z了k͜]po ޣ:/ʼG7(>o{=)fO0kqC*V?h~ߘ1G~c;w?h~ߘ1G~cm؏lCs zJ(]͍ǔ/ɰ;Q' J=RJF2L:F1g-і9[u9ͫ@ʹ+>4iSdVbMXt B&a*%&rP5s F]UԈF&%g.J`"Qr&!--@v]ԺtLa>K/Gs6\!X-8'%+JJώl`[vRR0U>Azɴ7,BvʴVڲ~oFЕJj֍h4uF{֏q:#GZ=hGY|RvelPWJ&і(R+Ak ڵOmZ'qV \qծ8{jA=k ڵOmZ/&:4ZBc gRYݓ1 &8Y ;.^AO[nnxJ]t!\юe=QcOQ6m=F8zq+p8iQ򋤏: %Ye' ^s aoV=\ln7~粫×/K<\K*5@nFNoKK<>1=QOTf'3Fbz1=Q5yGGppT) I$ʯT_XiIuP-566qHzU[-y)a'E,NLQ 53,e5pIs㹱? z(fo6y!n.YEvQT+!ݠFo3 T7777÷÷÷7·(ևe1씶R&i)ۙFE3Jj&(S@Y )j*0W*HJvfJYL*bYM:REkۿ>}U? G7q8i1f,dVk)+p,{ K=g)fD3BaeHJ}, &,ɰ]^c(ƣYR71.uR&1}Ɩ[0NI hbP#ЖYK(.YƎ{4sQTh;Aި.Gw<ˍk˲읷,pҎļYiGZARp XGd3qV'ݑd,Wҋ}D^O43rD䢶nO2XmPCkW1,o3G0́M-^ rR%'.|w67CgQ]Pb8DE h˳0űyvj5-eK)8( GR𭛪b51jm SaeTQ ll)5LOHvŃUԸ9rvNrћRR[[@]_j_ vn(V+:n6Èe ˰d0'ծQ&nQ[(SGU2}/T31G-(+ XTZ2V=cPF]Ó>?0ŏ|ZZ+ͼ-Y1,yp/ qI]+6ԔqMKG%"NUrյ^(aUш%9H\^8Ǘ^Ccsb_VPL</BrzbҶ\ozږIJg|($+$4=*׻G8eU,`S맞|o]0~sC-+8DE* j#A TB=qz?3~g8\q=p✼Vl@z]:Iî3\gq:8upî3\g[hs >u[ƪe͍ԗ.(y<2CX~&Ŀݢ7,Ap#0gk% RL4ۙJ1* gj.:,Ye@6ܫ34ɄM`!>E! ii.&Lfbv#`i IP- v֬-q31&s@\*(C-˶Ù;EٹfSk6C((*fUԌkHiJw=[y+vRUaI4(q qBz^J]saɅnPĊd\m&q⋤ вě 3"*rַ&aocdm/~$ojc1y[~Z}ʅ$2k87 zc{1ޘLpow87 zcs#uct6~A.JST}X޸ ePU\щ{1'|BIQտ)2FE**brڦ$B(M";X,oY\5ZL j,eTjv h5N'|O0aqM2hTgaLq3[-QriQj`71EǦU\!M/P̉$1}pt^FCbm+lAX]ackH"JYzNNGGwB hSXp@^R[u˶}\03+< ⏥qa L,Ks0,R /|h b,UbV` 6@k-j15Z4hѣFnZ|)[ IFs ZyݩH;0[JY7eabY`h b$<-܋bD21%<1KaS/J$6pB/!Y D)="[Ρ9«"  /XA\͢ڎ0!lTve2atUx CR& (]ٜp &Vy {8&ЄԙkÓ {$ 7  Ny DB3-KW wQ(>\$(ȬE6e3ȽJ٤ĵb;p/BQEJE+>x78#%:Oϯϯϯϯϯϯϯl^2OQ0hVH`݄.B,NF# PWB* E9̯Ҕ)JR|d0XeFQhWsX`]um/ `R6Ft@L S~7ǝ1RuC齁@"&ݑ,qRD UXA1=a`Ē1xq4v|3Uĵ%_KxcX Ÿ s` o2p(dKP`OYĘaz?Y?(jT(g!XIP\\tPVZ'%M A ѐbjK`hi љ \l]` )we7p,U-C\*L C ߈7fʳ ԩ܄ɿ&M7oɿ&Cd"'# 8ijHQ Pו9qqD4F ~(JS5d ]lW853J9:s$, 89~|AAi04 B4!0Ib%cH`kcBnaTeɧ1{E86G - E9Bɔ7p[X-G lF$'hOvN>};wiݧӻOvN!Wm9B(M6ڛSjmM@ xM`6F܎4v _A>E46Ǩ`]`T 8G jc-3hMMMS0 W@"o`bI US#,Xbŋ,xR^/8A)nӶ̲qΎuɤk2z)$jT?*B<. 7ƆwO}8>iSO '0TP P"$HCR#+&0m3?VaC@P+(`S&khFq.4EKv:Qe~"  b a*#!~ nMJh#t12"D6B4YJ E —%ER>( ~hZD}NQ,s u AM V&/_vbduL#P2*BP%lFh5 QEQEQE>O 6G^q[B'`%F; (g" Y[ P,h"Rg@ 36 &ҰP{ @GwȮsX iRks0MF@p`H k)t[K[K1 Ǧ$pP"R )4"ND)`ـ"D٬CHKs饝P@G[7d8 QAZ D B ۡtE$HDJbP<ϴ&EQEQC扣S^Th 6y;D&*Af5uH"Ю=7Ee07bk2˸10h^Y& EWK%FJ B`#7pqG\U`Cn),Qӄ`J+M1[0UI\\,fK^zzEܜ>Ą [" @@@ ZR0MZ !@0* X~&vCc3A0 B2 xbUKFQ NQ`3H ȹTVleU@x6[nQʼ@f]ؚ5[&2Ol $_7V O,Q ³|*`6cb c\($ii66# XN+ OĈr01wf-Ug3n&tcYK888?mJAf!@R  hŀE %{"ecChy>@MdGWxϔr54:E,cc+/MT]eHBExAq)CEyk u0àDd%05BȈ!Jʭ@)\DzG3#p(J2?rPXAՉ!cql 5 0uP d.^ƄAaPp9c ?lÇ8pHu}.)]8EYF~@Bxm3>g|)}|3fHD"zUOFep;»iiiiiiiihGw{GT&=ҧ)f1m(Xڧ&с};A8ft8vG}?J+S0q[ 8=)(N掐ӚJWE>Az&ph>}Ǽy={ϸq>}Ǽx1TAa10zU O0R&uqn:Y7fuq3Q0gUba(H645$c2#!A2DK}'OG>}d>=C@ hN )5J \ 0 PDBcn3`zPd 9x^ lt.C2J5L063UX%-4HXʀ>~r1 2L`g(Dd>bCHwbQ,oe@ 26PБs Q%7 F(Sާ$|`MA"URJloW2L٣iqqqϨ[  (Mx$ri6!": Ceqk1ư{a#uaQh;g/V(= FRTd)0bXq@|6ħSspЅ"PAPk4jX`@ߘDٞ l+ƦUp8ڑ]#cj7 h=fa!'@diE!5g >*J=37K(baI\VQEQ i="B C/o+`amqqqq fF8nFbT?>".H$Wдt "z# 8Dghq x\o /!EC/Te rŀvb`y9 ;OB*C44"xW_¾'|O B.t^Ȕ v:|nW 鸂 02:FZ7E>AƱl #F<ޠQ<A1*)TkE^P_ _@x*EQE(:lg_X Gn)JRM1Jx ɷtaHY,@p6I!pu2R6I7䖾ynr],00 =ray9!Č Wz%jc: 1TF2v`JNP9Ѱl]> T,fN Ä6`FdlH8 ghd)nw: @5ؓ c:Aչ餒Pڇjvڇjvڇjv j-Wpd|wȻ ={ @ Y҇u@ LfFpP J$Rt'pT@BO:Р.dQ`0h¤`qbVvτ1E*}#HF6m#i58t93$4i2j#` VGEFֶPnR{4p=F\!-N9E$w} 3 \S_dbOB24aBYVΊC8ƏFuOXzx?<y6cn*㹊i|\ qmP0ס ( (P%@RV6TDa AbT0HR6_ph[˜Ǝ  7 Psvxω>'|O, ET& p {tI--/@RAb͕I^XL.gX]OYz#qG=g8Yz#Wvx{n$duB @\0KAn2 °8F]w2ݒ/Yo808Xai5OOOOOOOO{I°{@l 03U|a(A $ &ar*GcC F=7DV# ^gb8|TX^8K `M"edhVxpqpTg<3>`7#aUqO()B#X1Aj. ހ!5(Llw$d0rqla&vbh*}V.6SqH,mbP\NghBTi]yF8cjzNX+I>}?_krA 6HOpI L0H%|q&r3I5R X2 lH'fX ֆB2D͠YqȨL*d O,4NrY80 2 |7wRMTfxR^B@u+7Pܚ @&xFX&fn!.bGДI!`Wk=f ApDy]| @")9 SaP뗝 `@y)McU$_[78RQi􀆢ŁI@4]**H[h ?u(AȡC.ow1s*qBI1jMw pL>j/*)CAP#N!,3ȷDc\O9N~:@)I6'PHCA2sIMXp@ffA2RgUWh8ԩO *"/6,51ׅ:$ Y6?44 Cò%,"dC,|;7%U#0B.]vSݧջOvV>}_LϠ\$] â"CӏkZֵk@UF,C8WTd?• D͈tmE~G2  mVJ}]] 7pĴ$a!=CA=D$&2x Y4eP288?#6 !# Eaaamt`JL0AD8ȷ#3  lQ #$nܘ yA 3DVqs`@cR"^9D&4M"iHD&4FQyDA:͸W: !;t1RFRٻE_\97p>ZDa=FPY y T=YvN0caU@PEQE(Z6%kJQ3L{ RJn̼ ¿Hc8G)M>.;0Qq$A; 8 A BH6P-*Eۛ8VD#p:A]C_:r}$,'0&0E?Gb )LmimCpp " Ec^J@AdH"D$H"D$H"D$H"D$H"M 8HTCpAs;3` ^𰰍8@2aL ̙2`a$H"D$H"D$H"D(9SG(MD* 0C 0 0 0 0 0 0Nq$0 0 0 0 0c<<<<򕇜&!<<<(#<-K< ,iN0b>< 0 <|,S<40 4N%^ 4K,ڂ ( 0 q<0OpHҔ&]* <;<<<(ڹ2 s>s_tYv`w4Q*ipgA_DT||@Ќ|kUyp_+`Ib44ݗLorǢ{1jZvk[be]e'أAJ4تߏIpZ̆V` UuE߰ZʦM4{'qge)E`OH"79YNVLa pR_@aw<*R`C2&vU>RJ=Yj/:s}ι:Q7 #|\C=Je`JJR SR6[7w%ĨMU{Ui:5=r#t>H#tHo~8v,ŊUdn \K^_l _8dН[tL[GM (n%Ђ1SEߖ;O rzWBdF궒-۪+}rܯ)ϻ(iawD2rJ)6݉@tkU% V/n%[ϖ·c&2* m NoaH%o Zj|v9cѾUkRLZu)C[QKED+سj7R089ݗli*4cUĕ*ToީN_94r| @! P;L;7I Qs:C4Ӳɯs%9 N< ouYp%f$::::pֈ$2eq9 654jRQp4I666 +K~,B||@]gÜryq wo D K`J%v22TC^1 J7I Ss'/(`H Xؾ|YGXťG'k@Ty'r%+!1AQaq 0@P`?P[6RVR9ٜut;w)SyFAC5v5.CwX\Te8QB/NN;w)Rbצw Z_pӻ׫S)p1gfAiM3>;!0+s-#2eq*E7XٺO]qroJ%[|@1[ : K%dU#IGw.^eYYE9{&0>~y-v[u>^ aK.\r0j/9Y_$#e} [VlK 5C4\HCu0 pbd"x_rE{}Ĺr˗|%55YD1'h-Gz$mqKihc)߉Rծtc(4ow\OdTpi Y6}S܄,CMS Õ \J[ +),iVѼ+;9u>_otK*h3Kx^ etg/xL6^R*wJ0}tg5/T|Qyj)ؼ+ rdwؗ.\r}_~gI9'3ۤ{tnt5  ԉg4u\kW \y@hQཊد AJ!mF3h3sNI9'?ۤc RoߗCH & =ԷR[KP|ͨ/F%/4ח S-=Bѧ uϼvA8 7~4{?Pq<#UcMqZ`>eߤ|]bZ;)·Mb3l|-|oF%p=dh J_g.{V! <>¼$N9$o_zjX'DL~}b+N}em#C׏dYg+i|;H,cxBTo 799eMLxn ce-W]{LVU>e_SLQչl+|'D-J%򕄀/~.:+ t1Þ]WS*؁. SKJ`\V΀Fq+qNؖNU;.e` l[-6+]3! l JPJe M4SP:!?3?p^ by3PYG*sܷkhAy}&BLV[#5c0;b !YVb7\ NTsuΨ˿+!1AQaq 0@P`?W/\3WmVQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(]o(6KkF/uo-;stQ'gYlQ}f%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%DQ(J%՚dA"(Ә."eF9\f)x,2)gX~`K t`t>q Hm ٍ\<㢑s,u,AĿ:K;9W^eyW^eyW/iu2!t|&Mr> G#d|2> Qv\-@Z4Y-5QBDv2lT՝mWQ\h♽ C=bml{9򎛩P|&)ӌ8 s\Ef;̷ c N ["P{!::fcM]\^%J+Q̿浭kZֵkdg*]i [ wP+p1#%`ew$ގ1*L9jIoKZ)mL?y?][Tx.7M=hM*"  uiE.ƊֵkZִ2K riSX hC; :J@/\-XU,AT@Vш0rc)ޜK;AQ.jSkp=~Xy0LZ 0`9~QH-Yݵ1P`!eRZ芣UG+3-e)N%xJ'A JUY^nlr6q5:Av 2!RKj w>M _0` bHU]5ghb0pcP;p3]mbA0#1eƻxmvWW]׎% 7^ I (CfLQbOKwLiZ10zAÃw29EWWW^erneq/(U6<$EaYÿZ@YQ A9jrll.P>wbK 4&ʞ򬠊L gäa *) Aq%\HA_ *BB3@6w) E v[EezW̶(eZJ샥^oϟ;;s@y`з%t[I*I%o lhŝ@6G)ľ3%mJ\q?f$ QGf,l ,p/I4CeCB5(lm}t gN:tjTe}"KK <MMrʕT35V)0uM6F6QpiPi@=u6OM\Jjٿ0;\VL̳tE,oWHZlN:D5\Q|7j3jUԒ.ýƔf5-(氣M .6FNH v98?۬O)^Rk5OS濩_|>k5@B7R i#JC:S oK$:sZ;8,by/e,݁F鮤Zl$WjJ*#AJM!.6UQ19xĦ eteK-srJUA,bB4#qXF@cA {#+-ZTO)^R5O~ƿS_|k @\U1Uى{\/Va$j3I$^/zoodb]bQ]CH1Kɡ:d wܴPeXB]O((RU>.۽RJq)ħJq)ħJq)ħ@ݝx>3i}P?7JiN p}'هT Ex1=========VԀD1|Dx0MjCm)%aE.^qhLLXDmlޙeaܿ?.TkƜ-k`+ a(|4lP^YN(<`4E %n zܪhֈ4שxPDne#(Աf S~UXN–(1Pr7rDi^)zg4M`@'''''''''SR >,13 (^xIjGa:i}b}Eb+̵0Gy`TpH2ո*T`qh6BzZ x>F7$< 9"1F$B5 4b: P-#,K-1 ] ٨nyD'2?z8LCB!}N:tӧN: eD lDL>|f XfH?'=========XSc--@ `.?SpZ03BE@qK]zGZ!n [~)`4cVZSJl6KVUyFJFQ%nd+9TiL 'O>5-F2dP5Pab`ZDUjpצFh]j^%-sr'O y֝i֝i֝i֝i֝iւo @ Z !JXz&ɒ jY <[vy: xηG6َ\G+~0,XⲋZRB$mpFH.D]XZ#DkFUw_hѣ4hҢbȈ: ;bxN{a~!48gVk0_"̵!ԝ ëWŝ~q@8q.%K~P\.=-M]r]~eC x&2("š4?9[X v>9aasZym+BTzǬtl;Ap؈YS-A4(ǀ"WWmV;f,~^1 ȭie/ا@a|du$L^]Y03]&O"DU\-~2h3^^^^^^^^,܉Z.;)yNtg\z j[ M3F#]5Ңj 泉wW( zm\='a;)o^S Usepm3EiZnCBMh*?c UU8B%, eM~DIb 4v6'wu^ 3Z\[-|IlmbҼzcJܷ !JWbv1WLi 5zʝ6yaFmrciG@R#ھ)@X /!LZJ ?!ǁAւ%_V=4k > R-Lc //+2D2 EPNj!t˩Df @\<,E\E q FvA&:A a4bdc+b+'{VCY8Èȭx"daA; MaoA;[[\V*2iEs1epĂ4 **. R-i[46mPP՚>{[eS\ r'ـ ( woX: `nd. tk5@)Պ z?O+!Va&۬y-J U7`/;(#Gޖ [ UDٴ5DfgBɣ5FM4X{B#֙6-|W]8nČV3D@ዮ_<~rh2TJd;Ƥ1[&74 \Kq`ltȉ*AE_:km:o2.,}!1wKc);֨t0J+|}ށSV8]4 h2jfYLHڋU&bQ%Vh2bգJCLՖ8$'HkR鰎,Q^Z'$v4. ;E;_SO5>j|SJ4x>3;WG-(3X;OOMtA#xTצ5`ԾbJdMq,:*Fphhuu=======> —ģhx."~jZyAh{"j̭rѮh8,(jm3X"uVMg0ͨRxc*(Xͭ5]aL Ʌ3.\#8N:r)"4*0m ԏ l,7 G":~߿a,]F7XՏ:Exl#7@Cv #-M *p[9,/s3~J*TRJ*TRx34~ n`j8aȸ)9F15JB5JhU@])-Ak`v]Ljb+=u85?bN78Fʡ0 1r28=|ŴPzZG( mm Wi&f5G*Ʊd%[*4܄U"3GUy)JX)8Emu0pe { quUe9_b2BUW}0|G!E: RͲvGXT+a0;L蠬Kt-[O)nRD(7#(Md.ѸK$Fob;Yh _ %-3lI}fkbľ|\}g:;opjMe<xNPZjxyS {8?|fvc*O2ܱܲ*vP o@;)Nv>S򝏔|I X2}H(q<< L] .lҨ,6;څj3om yfNJ?h[o ?i4h@T,[ef0ץ= ւ "] )RSԀ@PuQxRJ*|^N 3d^a\f1/@k-gȅK)틁nXͽ_ k/H\B)9_0h2o-R׶.O=*8$8~b Id/IS'i eЙZpJ(BAϬ0@h'fjN% 4H]߹|k>5ύ~ƿs_?_nNΞ/o=ͱ;'d읓vNɉ yíH" XS(R333331=G&< &@qi-%+ PPBb^0 +Efka d$nⷓ_EԻ^ _ +[ބXC[zPm/KeǷ1N m݊O x9oRB&KWP/2nm .@B6FUy庠8%Wb\Wa^YkW>MyZSKmQg-X&Nk2 ~ = AjUar :2fԻ5rnV=hH M45!@u lw[4V\a{7{{{{{{{{{{{]у@*U,ڃA08fG1gcTꢅl *Qd;u6%);gl흳vöR-G܇Ub?(hfY.|p:tt/&u, Hx/0B+:>>j^w%h s6PM̰#~6Pg]15:NuӮt] A`(8 .E)`!am2aVֱI-‚l )z **5: k\rD l{K!]C4 Xh,/Ai/r_zF6-rmteaXŃ 3N$&wya`?-QlI4|>i4G#H v0J)E6Ǫ+%7Of?+TXֆOO!J[,M4,;>*6s` V8p<(AJERɜ5fѳnYsı𴷩8כx\ve!+ x:n&@} M-hDPjkU/ DGR CXSdgm(8`ҷj(ոY*D(i0sJN`Uv\[+%xmGcqǽTC륿K/_TRKꉩP_PXa$bNwIF *_ҡbWQRlO ʖ.bQV.!A\\(<,dl `]&!8}- KI`՚4sBؔW tg''''''''Rg( :Ndg?ue9ܐYA -Ji л:b+Q_PD,To!ӥ)8aev 4O~3f5Gb7o@BJ~^sP.D;"yr]yK-^YhcN wdMᦲXxvJ ^")B[SXi"!>ר&a\m7 ,VJi)nJh^ 6Cr1|K` Xअs>& eTK"6j=MgU} i EeKuIh%m JQ `pP5&T흳v;'d읓vٶ ;;O1.nsrs(] ; p p`@aeK C=;c%݊eTֆ:Դ yi4UYu[x\Ks%ۦ)[&n&ά -7O]20SM,EXᨄ ,@D We#"PLP+\|Pp;J̔08?O5y m*S7djPSe# Ua&LZv+@Ahx`\IG|b ؀] 3 eUҼJ+įJ+įJ+įCݝx?ΘMD E(a=7\,+Q (ʨBtx[\ QI[p->3y'i"Svހ<5DC y6=c$ "]Y,'S8v2x;˖}*}DaH)SzbUHK9RBviYo,#MBe[fzˡQ@9\tP%b޸۠cEЫ`7ՂTlJ_&ܠ,ɮ-M즐O?@StWs)ҦhZquLQo:RiQ ({+Pk"(j/ЈF NTԪ1rK,6v"RZy,,NЂ@+3JI39|-Y刵i]f ݁՝H%@ *uS̴8dK2SfqFbp-rՠ:)O}n 4;=a"12`5UR{M~3g?~3g+LK#NGt6D &leQ/.Ex:GZܨ4j^;͍NBtmXI^)W*KѽZR/Hzs32]Sb3%ܾxf 9V2/JײԷ nqx0`j ZZl\й,V[t,ZBD 8$c}_!)JR:9J ς~?sO'yGL6w J%?ΙP&Ma)Ped`aJծ3k2o+U֢NhHڱ !hXdw^l.P` `-_ Y4p&X1?M(w͔ah=UX[QUT7e[0HeeJd#D"ɩ*6 ; E&  ݴF$R,޺Lz4eWv6hu Q B-&B|+Jm"₁5zыݼkTP⴩iNPns[}َ:j7ܱu6c Q{8NiJJ >ˤle?V@a{~~~~~~~~~wi1VxEn ,TqfUg.)~c=,Q̴%}@E2άrW+/W&і[P!-Qǟa4&cơDm]UMjӈ[nvt[ʅq(+f:Dњ?|O:)NtS?K`Vt<S.9\d#W,2q(B2c`ܶaEBx:[*,9m`U\032ZcCe)qeCPy`njh v ~D/ɮv^?~eZ.Wk^wq-CHUۓwN;tD ̢;lDe/4$VKۭA*:RV#$bA1 NȍU)-:DD-<&*dJ~Q1wlt|c(bJ;r8b8pIe^S/X  SX+ԾqH8MoY`l R C\KER 0T) J??W\K@(@ZqѓVy[%j^ecCaywU}OeSE| ~L?h'#p݅Q ]ӀURT .s`ko,T!NJe#XbP`ħ3]XDaÇ8pÇ8pÇ8pÇ8pÅ2٭skq?aflZL;"& SWS xb5ިdt͆Mh2@ۜ ߴ}N.l9se56Q!PÇ8pÇ8pÇhj]^ F`)y]'g9~ endstream endobj 83 0 obj <> stream xӱMQEAȸp +[>eW:i9P0漞uPs~XQϐg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CCСg3t: z=CO8{ok~&/>W}rCCСg3t: {~z0}?~u endstream endobj 84 0 obj 1103 endobj 86 0 obj <> stream x\M%9rW亡ߤ%( ػ6^ ^3nLߩ8'P{f0 t2P("tŇp?Ƨۿ\./!??;o|s_?:/H%1,z&6:֜/?\ Ҭŗ( ҏ﮵ @FtS?_2 ՓyZ':K\51]&S6Ƥz5V7ٟ ]~wztJX5*vUPTrYX\1+ƉF 4.EF q-z:5Ac !kx^>/ JcmaL{|* Tp7zB-t/v@ě J!"S6Ĕt*bJ R..F5Ӥ)ۥD"`UY L`l uw"$ Щbwv E+Y0&+%rT&0^uJd%9qAa T4(n9 MyZ,{liOsL -k/4=_*-IX5`L1*0dSE%.J bI/'e+0o@xIMQz[b_ld_d_2/^2(a EMWġ1)@aJYsG"rt! #dTaNl"]WL}NtUf{+ ~>12E4LѸnw`k3Ntܝn#h:nws绣ߎlvlكf?iZyй۱9WG-`ۡ};A Lpa (nƳ.n i`g Lt LPpk n!Z̘oa nZn@CT3֚ gXo!w"ֹ{3IӇV[(S=Y@[r m u slKK63ޖ 7-4E,|w3;޲fwϧL+7ɻ9~[#X0SG* ^{0Y+U=U~UVfeƸ{F7[]^ *׏VszP^rk[zm0S)35Vjugj{[/\6-/{ܰi-0˺~)#~ĮWWc%}P:n4WMmfT 897Bqnu g Q i숛J2Ů+wf:D:Z&-61=n"-ֿe3?2l!&?Y˖͸{c2-7eM32-g2[fl[6{h2&W=_2[e̊lmyas-+dBrm?cٽZ`[^k[c7ʇj"[DRZ~X ~fq C3tpf$'aQP;ҪJw1vI溦gHC +?ɗ ,]!^o$X{%łjA a(5uwd?Z- ĥ?'dtș)оx2ZM\w]a?^A6-EˢnLϗ3K# O,+ Pq1zhUv3+Zi2E^V k"A<4_NU&ACnd(AkA@  )&dL|t]xeHXc@Q7OW_4( D4Sr{)T"aaERoݵѦ,Nm*8@{Po)?ޠGJZ^D-*,uaw*/\I/tlКNbOGXf-DX e 1T&  : k/UOMjPA;I,>p7XISe^y/Fu,b6e NiW,jW5i 馘@v#E )ԧzJt*m !kQC`BxBB%+GNG7}f-dz Ƨ&~A _0FQ%C&K'LGs/٭O0'oF".x1gt^i966yɕܣق:goEb af+/yZ{=Kw4Po4ݯn|/u@Y$.)Wukd"*]~޶?sߴ7wwQ&~ =(! JH=Q|Zb=_{Q1QCNI$x?7Bw1gkruWeEi*8侸v@โc#lTqre^mڗyRjHձ ,!u8Njov|㗧U_׺ endstream endobj 87 0 obj 4721 endobj 88 0 obj <> stream JFIFC     C   S"  zS淥%555555555555555555555555555555555555555555555555555555555ҟ5)-`>)uXyZ l0-L6S l0-L6S l0-L6S l0-L6S l0-L6S l0-L6S l71质`Oޔ̝i?M.ʽl*B(B(B(ɶ+=X6Էe=)[Ғf傝`  } v}PB_T!}PBaXbdV9 wzV\8DؓH[Q;iSEv| Qn_[~t<=YUkHd+*vʟ. 7y>IIV16.q0=#e(vmր1r5;=+&fYq]SLHsk )jRMLٕ(ayOAzy[{@asBʆ. tRyKle<\KXYLlP(Waq.=NnyyS6m~.oJއ$΢ۥ#>],HIRay;eOߗ~+pDG/>g2#-)Nl3|y'TrekHm45>Zoh]0)7jL0~y82M(p_q!YVc?y}˦_<їl]uw٩k]/Y)ˮ&/ʹɽ] ȯ xOfo>Uڮ垤7`cdz5"Zq%~f)")7jL0~y8oMj6SZ֣e5,܀94ͮOB) Փ/dt]XB +B @l]uw٢an ֮q58\Td# Rv}^8j|%DyV6}|yPKϟή:;DN:̍^m5(u&_?_uƻeH|dFj|vߨ"nqv?i\zo7cIlz<̷_?*ɇ%mNӃm )(*>iQ咶(I/?`^ 3}f Eo^{09'yW6>z6Xڕ% dF|m⻚zI 9E0[͋.:.~C?+>B$2N3..}|}yVֺñ'5b8f$RnԘaU-u] ?&3 `/w~qARZuXrc孻挋k!SJ4t^jKߖy,<͟&2r9kWfd(G^qxQGJp} ׶.f55']7[{^R[p0[$ɊW-,ch8/OW+3_83@uK_8ݝc"}L- (nñ'5b|ti^:[;IRL/sHQ[q lyO7`E Ѵ` F>F\L~?G~?G~?G~?GWl]n;ro/7gk-esHvK'v?Hwo6/vn,8g9a 3XGތˋ_?_AUGHᾫz(K/݈#? Ħ\&_?_<*JUVZEYiiHRrmhOȏ. `}_a4+Xx#k3CKzu~a .뮯i^ohkzRZog#I $h5oMK;Yz2"+NR-v}e^V(б6B"z*^FkIc/4L6H~pGfYZȭ",ز+bȭ{bp8f69=)[Ғ2+VXZUaiUV>s$QUӒ.ZiT*hB*hB*hB*hB*hB*hB*hB*hB*hB*hB*hB*hB*hB,rǦߟXzS淥%@tw@tw@tw@tw@tw@tw@tw@tw@tw@tw@tw@tw@tw@twҐUt?6 0562%134@P!#"$`&7EGlO%DbsL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL"aE-&i0IZL')j fB\+ErQ"DW(\+ErQ"DW(\+ErQ"DW(\+ErQ"DW(\+ErQ"DW(\+ErQ"DW(\+ErQ"|z5ɊQ?$yJR~%tQ{,Oȓ%l5{ݶ54%)c0̘ILg.9tˤ]&r3ILg.9tˤ].},,2HO2Q/pppppppppppppppd\;~u[~;4|;.$+tjr֛OK,~*)Ö姇-<9iOZxrÖ姇-<9iOUUcQLz z?baewQLSS,x ɲg.>2lv<%I}v[Mdj>M6R}n֯4eZBQ*䉌DLHjMguOs;cmH`QhDV&3=cm!X9}S^0T0|'cf_o1 GjCO㰜Pȍ?ɚ|n+WcFLj{H+"|yI W ֵ"+-Խr\R]nWͣp.-u"Mc}śIuE|tb;uRipdw""f  K'#ϷL!ja Yp央yRCi,?XL 5tiDs~mAx^|cQHu.9Hse0&_'u 1d~Vvʽ4wWiK FD4XLBjcSE"Vغ98p@vUdH"t M̵{!;cT)͠AN3\"#Cb!9M}B#X\3@i)8HܶvW h硶80"d-N$6V`#9c{#a[ ƇV_".s"DpZ+>̋3OzE}^Y~,_/ŗeY~,_/ŗeP>S+u,;mz>£18pݳv,?Xᄅ̒H+u@.E>e=#nW]a03wNbŚ#&]+?IrK9ЌE[Mu澟 xTT#^C&b4"Q'ŒX›q^}Idw}ޔ j&їx22XK-IacQT!wHč̰0@pya>đS9OӸַg-jECJd6XG_s c!3SsC'AbKRi}$,sdt;YIm>7wL;l 0Z]>wՑR?f!̏Qg,̚ B68cn#C\4-#}vLk'9GGѻ}9/&3rF]8+7ؐԦN|=Ru6$+^9:bLUi1U*VR!:(ǡ$Ty.?[륾[륾[륾[륾[륾[륾[륾[ꡨYnwQH%ӗZJB%R|X8lȿ OUv5M4iYo8~9zVf/:f׭)uuv5IE/@bYX2?dvlcd0r'"KLNd+ݏAw1mz|h״oڮZӶmk/Y!~9jv ɬaVoL!/%9%Rvf=(V0o G,a#~B֬]o\4\4kM놋!7>\"_{q>m+#-H:2{$p= N&hhcuȻ\vF}UȌQoH;n_6,dDffO+0=hS D)/>9sa=IƷ~9iw?]ƖO  w\in~>Rs!^0BKN DG& 5f{n "RPJA0n)3n0\.JdÑj('즙f0"  oȠDH^z dUiZ]M7Gݫ6dWRbѧMn[~/Xz߷vmkr-nE.][ߣ|zGY Qo2ČA'񟣏_vQ8vQ7}ӭ4c2rBE# ^; 4qrǥe3!2$Ie (>Ou ^1J Kdˆswe'?Ս}4ّLQXEWJ,.Ub|h+6CcDLʵVCr-a$3[8ycԂ\uԲ֟m\햦ݱGjm6=8Ǽ6TxP0OewΉ|bv b!RCF@0f3@oۃ\b<gٖ%Յ*Q;wN{A̘Cu7UnUuV[UnUuUv;Ywf;lrmِ\d7:ś|Du6ݙWƇI J3/%ҺŽ1s4Kz:߷fOKҭ/uΓzv{"Ǿ͏~9>i(^fC#4C6[0VA.[sS QE lbcŦ-61iMZlbcŦ-61YnRf;s!X܎Kҋ_4[r׬ȾU_QXqx[hǶ[jW>хejh?"Ō!.X~Gݎ7k>l+zsE2OYW:>uCđ>=>7wܧB镥iu=oJ~$F1t_MW{Ƚ纙c={0!+TW?DD.6?!Um4W +ZRv4޸i~GU>=A5M#GYngfiaһK7#hf#čHn[n[n[ncN.4+2m6]\L~ͭ<)YQm'>MVUn0hɿԏ3OmW̐8mcW{2UrC r44ĭ.%iq+KZ\JVĭ.%iq+KZ`ewm?.Y|8ZPP)@"1~?GqÑn[UnUuVNHmXIޫMm{nE7nfLҫJo W W W W W W W Uy?pY ^}wޱh6^6}͐l͏d" 軝&~X~4yV'Qawa ߷|PGЀ %- h@KBZЀG[tG22/&i-qwWKZ\Z֗ŭ.-iqj& 5J,n̓C}qT,w|ʽr~oy֚;_žZ\6 d4w K,񗏌|e/x^>23!~' ݯ@Dr+b͍nD}e _(b)OO&4Ց䮜폰% fC7%9tAˢ]r胗D &D"n%,[\vsC8كٗA,&8'6Dӑܷ-rܷ-rܷ-rܹ[q>#/<|qP*u9ͮsk6ͮsiLgXazm\5ec=I-S6&~' R_P&-ȦJt#"s d ).4,ɺ6ۿߑw|jB 8%- hpKCZ8%(" o00vӧaツꂼɖVM1JZT2ҡ eC+1 _pdذ'C;'D;3}J.d*ϑ-e]8ޭlƜ2oKVKvQ=!Xiw;2V yiO\ Lf^Ol-4. qٲAd/ !~ٵ:i_'*|Q_<]  2LctʑFC!NB:ce/ e<R6Ȟ&J%H''%|n%L5 ΕXqBӷ]Čb-pVҖz晤kq܄XMme%Ǥr%%9F5D{#/6RQalz\m .iZ3E;z+ȀXV)2$3n0qI_H[G21="9:H~4gmSP˳%L=#m+>%Y^%Y^%Y^%Y^%Y^%Y^%7AuiD0Z jF7} E 鯷[2`F2B؅gim˷0؛oBІ5t! ]jCWBІ5t! ]jl4Q#r暱-rΦT.1l-\W2̵s-\W2̵s-\UHnJqc3yINav iLkq(=R4udcb-$i IZH2A e-$QVJE{IZH*AV U$i IZH*AV U$i IZH*AV U$i IZH*AV U$i IZH*AV U$i IZH*AV U$i IZH*AV TVXo\OO3ҒB}truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']truwG']؟Ŷ}Q/>!1 QR"2Aa4@b03Pq#$B`p?TATATATATATATATATATATATATATCec5l2[$^ dlx-/EH|p@ߎ{!f$Nkew]lWq[+THWl߳2"J"/vSU)f@%i5CI&A5WV3EkEr~E *} _C⯡Wи|Tx{dP!9dWH'"樮(e$IGF!6k42^ M|otݗWM|otݗT-f LOP T7A'nd^^^^^^^ge0 D:atUtUtUtUtUtU=\1{ 2i co`oh'\G87b!R)&CWPU>Uu]CWPU>U712,醊#ku-ZD\iؽ,':gh@[х1C/q<{Ԩqj_pUx (qa5~1&MvJxjݻ-MgVHB~fBHaߩGx"IȬpnZ?2gElVvPK? [%-g dYX!eĈްlԧCa$.d*B@W=z4`MK0kLf?%Cii.kk9(UK~?OW JĘb)#*271lD6JR3sO$8gZLcꞹꍞ#jfd -d\Zg5[gL ÁT_w齣=5p܋ YUE_S?/U|݌b4MZc6y7]?7P|5xӮZN(<SFzBن! hh+oooooo-m KP^桐ִTP' ?0&sCa/KHeFn 9mX`# V͞E4,]0^!8 x*[빥4e0_1Xcd}Pt ؽ<%-z3GCDʾASMaMjekIZ k2 작i}3-Z=9iM\P126X!;nnCeP%$ƴ8+pWl]g׷#TV'cOr|7196ii-oxQ/Յv>&4ⶏm?5~kh'jݏqn&A.=U8 &d3f}oA(AzB殖Z[AǸJ}nCHUo23lِ)!}[?Z(Uz`uOgj|iE ޞRZBu"d0_-_czh@$Eij䝉(=Hb'Si3qʵ*\~qʵ*O"D3å<6&!:3_:mfFuUB<\9'0G/]̦RH&3b^91B:'Lli13C Q0Qq7QP{I{1*i]\u#P(MAΫUlK[c;?C q>}Z#~x :ZCٝR#|4F+݉UhsHS9 CV A3F75QTnh5Aƽ%Dp-?dUkW]%wW/=LA[;Ї愚a1v5/f?M@$R7):UBtg7/h;VK՚7ICp@x^mg`tR]awmW!=iWvjUݚwf4IAƽ%S!2#D_tJݬmPTdQ2RRڿm_ԶEv'U9*%Twmjiv#ݍzHN}8?q>UUcj0HL)'bur v5$SKI9nV=onV=onV=oQ|:9o>G{!hBe5C%T̠V %'!bdEV(c_>J䭡"f¯S3,0ʴo$#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;#*;<+cy>YZtR$XryC5fhvVJJ!_5(+Z?'4v1ics\]湦sMwc755݌nkk4v1ics\]湦sMwc755݌nkk4v1ics\]湦sMwc755݌nkk4v1ics\]湦sMwc755݌nkk4v1ics\]湦sMwc755݌nkk4v1ics\]湦sMwc755݌nkk4v1ics\]湦sMwc֧٘oMƑ|ZfeQX*]tqܖ7R+; HΉT$ $fn~6KLkm%gRNt)`;VmLJ#?@=D%#9'r2=eW/8~qY{Yn8l/:BBЫ61y#wo1y#wo1y#wo1y#wo1y#wo1y#wo1y#wo*YKPЗELHniR4(}dE|vRhr΅ʧS~ⱼ͟p|Y'yZ(/4F#Dh4F#DhܢT ɇ ̢9Q̱ixe4ÿSYNŇNJ`nTW˛>Ah'Eߜ96kui 0BGuy I; l ZJ*I镩R.A˓-8\b!98"quH$V}DǶ<>$O{cDǶ<>$O{cDǶ<>$O{cDǶ<>Y&wH8q76t>h!9GU֝W>Q~[H}m*oҺud(PprK2ܛWmV$Q/%*Rt^ZiP7=5hf_vZn#7ng K0L_n[0.;f,oOּ}}:XZTO=]RԄ,2^MQ4ͤ+`^miɨxS]hZ(; +liA.w"{Y-U$'ܐF)Jw帔6sQnm*DJ?:rK!Z_'ҫ!Wa( @YԷ]Ӊq:*Xҫc%|e)[ XPJMn(.9vf~":/0(=رTJ"Jqd#FRqN-+<;J&GkKHJʯ2g ȣ!OH7rFmWnh".^X߮UڴN iҰU HMrk_gKC2u!=0L/os%ZaR8,JLhEt}m]髩jI$kW(JoM)VY . JҦ0ܠZFTg4Y9TS9sj*1(MKu(_e~u-cدN:Zm9ʖhb|c LJ lsPG1]Gg ; guR v2E/Ss.SΜg--raYŶK 3 )O bHΕ,ԋ˶'95$'.ewʎvR%I$LGwRO'C2$\=ѻͦSL6Sn 9}];JUZ$T05tjJJ:VuJC7)!y*0$.dudl&iyZ%R4JWL8"bw'\%ħy7NԲ_Ti/$(&AL&^qL2PuZ7Ə}0|]tD( hm"@nei4di-#y"I6yձpWl 0ZAdR6maG?<%N*kwLdR}hWMDUlʲnnjxͶnC6)q &C}ILlqfe.ii m5l!TsR?Hɮ]s/pg-6~l]q6Hɭ hw%$[eK 1!h*g$Am*S] KFP;1ZM~ kRԵ b =Kʤ&~3 y}|->%TB,g*ʛ+zISO 8ҳAߔxUStpD6B_VXAJM3m![T:/Cİ-6\xfۼo e$)IV FJSw2L#&j4-I٦ԕ H/k8WXy hwbke*"p;-vSu@Q;8Ժ͢sX&ZJ噞|dBs^JʰȺBUKq#E:*~3~tkMoi5f֬6{(m#eWǐt!_C-ҿ<[y Jn12+ceWǐt!_C-ҿ<[y Jn1Mg,kOaaK8ը ?>^/$(g$,uUW TiIE37R2WOڏiy xjZDZZYEixQg9E$@AN09G4'ӧӪ4a?4rlWt@M(`*l&cXkYJK{7,8 {vMŧ a |crsÒK6*iXBeGBnA)Vt“d/5qGWhJ5T۬T+t3 Jqt\Zx2nFX+$WB8pEc5(IQy$l3hMwe2)W iYE+r,(fS2y馓,!0#Zu-C2;l*rJh:)"&TnS{z/mHMeC0yFV!mdJ[x~ȉ2PW"EJdN'J\N#ML-N7uAi[JxTj5R˦f>_8WZ;j  =6*xx!9_p\;Pz5-cحIa|_pmzߪ?Y*ksԄٖɩcՉyIѮ3zay+ɢvqjJA;jQ&FZMM44<ΒbO)KJUjm8'Nu7XM6aa->iIJo)M$ij>ȿw2ڽ@NC3 / 8R8)rL&la  UeQBx.2ouI;-ڳnI[P8!+}T rq{eEt.3=۬aYFwa.1ɺA0VQ~RFN]*CW7' l(-Ս+?ɫkj_y RҖK7E5S҇3q~nJ-Nik\ۉikGѣ9ZEd,[A,g [(APeM%*]JJ`S&:/WDR=bf v[:{-h-meHY6vn;>5rż)7IM_aeј-<1\o9o{".J@탙wl]HO؏Z3h>׊[/ -i?a ڴn5׭Ve/J&Y9V4F%\KBjyĴtfFQ #b@jCA=~!967Tפhݖ`_VlyVXQKMG?)CnMZ>;Z>;Z>;Z>;Z>;Z>;Z>;Z>; Оmy/S@'*R[{VuUͧuJu'E$K^Gv1iTwcGv1iTwcGv1iTwcGv1iTwcGv1iTwcGv1iTwcGv1iTwcGv)3756ĸ)Pkj8욎t9JXΕz Zra_ GF''ϧeKIZ3w|IL܈yԕ0ÔCS(!+@mYpdW6TAQ&}*eĴM|c3,̬8R#8go\83~5O%o0~qc1+OKg\L|YS|h 0*Ё6xb"1 HBF!?#O'D]uoJ+5Sg{#{&T땺(3i$+kx:Tե=a>2w;ޏJe+1Sh\SfVrk [JTh˚\#Ov1yY=^wOdb{#ﬞ}dF/;'1yY=^wOdԘZR}"55vm~h;vZ]S!W4Vѝvs}GGlh›G:@ricb#+J,n+J59\8*ᄲ̇p%y%I͛RGXM_'Qɗ֛QP#txOLʙ}n }LJ,;IOH0ɠ Ե b:ߓZkgJ@Ȭv[&NKhHB(7>Ufy_s<տtFU,;qHx ~fycuHͽDH LB@ؤiN;= 2VuV㊺R"ʚx]~m) I=c6G؝IcLH/Il^ +YWP6tD[%f*Fe36yTʼSJڷ0_Y̶phԵ bf%$%C :˺QQM5䓴s[7+x+4ЗBoJ$|ٞj}צT^miq;:G@ q.8nnWwPB\lBϺbVѨ|Rjͻ-o̰A)3/sz4{?!_U4IyieTbH4O9Y7Pjv&uw_գBc晜iTP9وnl|$uxg?6*bi Hg~ԶV+04USFCtŌ\)i+@Ь,VqHC).$|vi 2]8-j;ghNUMe⳩j}:S4VD[̺}WkRSfRq},!MؗvSPh$xf}:Vyh(}]ZcG VCWELL*ң#̃;_1iwF-?hŧ;bZыO1iwF-?hŧ;e_tI}&/4U28<]}pImY/]ukHMTi%@ اKh!(EgT-WH5[BﮕP܅JJ_BoNCe( з&]9pFyr#:I$Dl<&+؛^X<տtx%J!)Vo` -mR*`)-MJғ&Li)I$Px%"§]~l(~j>jy3|M4Ft1gG2Vc+ZJ黪wIe6knHߍfṪvViu'/䭄NY5rҌI+VF7J^O_K̡)}|bHF6ǨONJ~ru_S̼;-V8 7!ɥ.!` \P>ph O3[D:&m bRJ_1K&Wh2p %VVД Ȥg4v^K\A&Z` L%"-%cN-M&B2ȼezG +uY>qDJ|dhmk7htS?4햜 Q8T"j~RVu䮐Ҝ[b )JiT.2uyd'zyrhH$+S}TJUhi%hUpUMvARq7J?!dgV|>ˮL5YE_(N蘰qSY plA;h}׽Kz̛?f?Ese,%XtEOXG+0m+R$thaHHJ$wao%wh)OKePdet7Kixshد#+뫎K_+õ?E_BeԸ>&FN-%inw!j L}*UUD$T;P誌Mۍ"ZMReYE]TETBFq.}X5ZE5:"'|vl€/s<տtx3n}]C)TKvwu& M RNٸ>]J_QlԤpmՋ j2֭.VPJD:XJ󪼵z w[xWe$JEwiJB,BJ'eA\.IL-K QR)xrѼ @aFh u˓sT-}!gLZsͰiY26 cǪY p<8h u;vUGvGj/[觩(#Dh4F#DhTu#9R-.7>l{^Br&amw24KJ2¥P#o.cN)kZWd(C2ɲ4x6*B*s )YFM%CA*UGK+{CCM N5* C:R٨ԑ=d}Ԙ|CibOs@^_*%Di"XZlbsGM][n)mH{ JIxUI;Z#8RڎML(+5kAZ L}*U1fy~qC?:<^k~ %#Vo`ꗚ9ց\#"8_tám$*;be*/-ĝ7u$|ubu&%XmugpC)wI:I]l{8uÊ+SβMw}:N>H1~2"8}*l%jh6^ؼ'}F/67k+JAp-7)[Qq L}%VXϕ,wNm'<}9+EؑaGZaP0(sDtjLЬΤg5RΆ쌓u*:Twψ=d}%!#J4/_8~ KNfUpW~oyITtG5ǐ5ǐ5ǐ5ǐ5ǐ5ǐ5ǐ5ǐ5ǐ5ǐ5ǐ5ǐ5Q-/qmQq 4aiWWV6=O{ŇGxǶ,>q&_]! ݌e5JE/ r&u(e@ 9FS>ʙrbܟMƓeC:x7xMd-fr8ӴW0 v@"4F#Dh4F}RsBfS(3pPty2vHya5y+ N=KȝG*3#Dh4FJ:2m}JVd|ub|M,HnbnFry<{Mr_lMi˩kxvL*FM(l.X)kZ_EWM93 ;iPbXfК{e{(\LYW$ʅT$eL}-{He ҪRC&VaN.E?az=evY]Wlaz=evY]Wlaz=ev%FJjk| āZyJ; 1*[Kn绵;:<4{N}bc:ǒu$I/<_ly'X˶EkA|ub|EI0 92V zCm(>O'6'6ڳl{ڟ>A1 xIJxxpo@CM!-u(H{aZTچf£#\=$҉lo$]1kNhB +fdߏ(k z<\G5qP׮#yC^'&D?Uw&? ^ȳݿtj̡i ImYHj+ZAR黩eeܟ6`7)?(|B>1snR6=ԱA0-*ʙZYzOSy9<>JЖ@$P5YD;1wb‚JqfWLacS|2y+̦0^e1)J^m 7Fq"@JF`dYnߺ5-}SJAn+x,DPJp 9XIJԔta ٓBo"]*wȅ;2p|bp8D۠^5X#ujq P 5D&fv~_K-wfAJ&xiKZDZ^(5S.oS3Z<9#(WodHM<kuOSy99*ԬIb]D;/~Oi P$njHI.0 ݸ}`X̠x8(oHCP8%{"@[W ^ȳݿtjLNYjZhvUJBL*Zi%+ .˩U[Dg/?*UVi}',Ve*-c6 2@C7I 3$9p3艶%yn˷+bj۪U[A-bA >*f҄>vo@Fmm-q\7GkxiSE+ g108 g108 g108m<&,TF ]8kSwF\i9e8bNrO\2nVo ˜fM( 8Psn;Yfۇ^UkarȌ.Ss"0NdF)̈9 Z,T&oU\/Y'3 h_[Fӿ۩ڭ!B tڑ]ꈗt92>@n^uܚب䳗MI!%!)]kPB*Tw ܴm1.xmU0VʛJ5]`|dK5ͨ=Jx Bv.ҙ.E4f?KRouOJcbmjmZM;%U>7vjiԱ.мr ev-7 {qiweI7Ek L9nviU (n4rJ$ MKG͜LJ~ =_E6uj8{)~Ah9 (I^QrmMRŧZRyjbMJKJ%!Ŷ6n,TIl<ӧ2xbaQ~q>'|̍Ә^;P~6S!Ti qYҽZU7hR&,ZTܹBnMf⇭9kx]Sh~4'^NKŏ3&Cn:Rt90-e:E4RK|sJZlŝ$fe=@#y+k/qHB9%+2KU&!:~9I|7?9?l (rRGUm,'\/4iTk?:C E%; ws̘R/;m;:"^V(N~3-CMy+I~5򒶇*7Mm,Xfϸ<+gϕ#QW2]gYYE[ iΗ*LZV5ZyNئ-fqokGm(UY@6Uz TrOrsȟC*Zv.YםE*-!T 7Θ,kKw"Zh_wmչhOGNMA (w:=0.աmJvɞpinM&29&1q&S*Ԝ "B?kLKPZ 2tbm5M7= \l G3c54.pKݼS(^|m[Qb鱧\ҏSN!,X.m4 X%ӟ&)%h*ULUz3Č vPmDA>mA|Bn+&j6z`%QOhp?2EC O0TNMy=>9\G7q߮#|s~o>9\G7q߮#)k}"Ӻ$UWMx*);A_l¶|^5FQE#[1m!R2THIܝs_[pT O3Im% %]B+ŠS)R ~QhT\rE.އmYZRP[ONCKZT~pcT8Mi .yD־2hFN.Am RoMiZZ>lbSQLxwaE9 )W"0^dF+̈y|2#DaȌ>W"0^dBVt-9’ШNRd>s y<0HB(lšy5ԌƒKgP 40 8U3k ujФrrrrrrrrrrҕ72deOji }KQLIIG#&C^C JFrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrlγUޤRN}{s ȥb}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>b}C} c'7݌OoPv1>cy>մ/, !1AQa 0q@Pp?!U"D$H"D$H"D$H"D$H"D$H"D$H"D$H"D$H"D$H"D$H"D$H"D$H"D$H"D$Hu ^ʴ{JrIrI0` 0` 0` 0` 0` 0` 0`bf;ɨ0f*`sOLTȼ]FP O3+"س!\r&Gi} #N`oO :@`wGr˗.\r˗#f` ;A gr4"pMX,|˕ֺ䴹 r+\W"ȮEr+\W"ȮE&lfZef$,Zokivі@ĄLvй ApI>u.c_WK BGδJ O1:!(9IQ,.E&<`,TRJ*TRJ`JO:+ X,)%GnboFi|{9Eu|( 4RO+ƍb V3[ĭȣ$="7[ˤ`Hn`(`dB`K>=dJc*a4֤H[1W"}i^f@3''[D+a,̓Jc}9\1hהKNedύa R^o jDce)6KZ`ՔF"H\ht$5#6.XӨ׽#vc֠7Wxzl54M-Tě0X[9[Ǟ"GPw:EaKNW0=v*j޳x]n"X̣r-I"r#5-t蛚@tKr椏ujʼnx  qAa9`9zM#[3Ҹ4,ƓLb R&U$dكM)-$6nkZC%Ky5Ѯ.1ktѮ.skV;$޽(֗;wW?}_xW?}_xPFg{38gs<\*yW3ʹUgs<\*yW3ʹT# Cr+`bYa/e+k+W=ԅSETϹ@L{ߋt%BkpP2$Yi۲HrlxHaIe5/l`3G)ax4'\zցQcN%֙iYe|c}yb r;4#; ͨac6LSnm*RX\.&ݨ_%ǃhtxXȭ`xB]Iіlm۷nݻv۷џy*kL5GPwk bbѽ wE@t޽|HiAf};@` $JWI}{MMµN.^۷Dd(<+#KˆOUhW@%;Բ@c&ix})Tq2h̆ZBT!T7'y;aBR.u(!Ԕ=h Fg={;i$&F|=q_;` p%3eZ?ucX\ˣlt|>+r >cu`jv!|zN9?!Aa?ӁR B$"IYB6i"OVDe&:Xrh @d޽H90ĵ&>`6lh fߋ2%|i=O4 >O4 >O4wd" (t3(S'iI$jjhZ ES `n3AepY9bd1Gv8T.8h& t5؇xBT&B\Y$O&g%@F) {؆@WRI+V: Y'N=Oo$_a4&ob:D($bչqH@ӚC7qФRGgkdDޯxu ,D֍_WP?d]'09 rL҇5d\NTE9@H eZwyRP0UZuНNzrJ$rVEU.h+z+WGGD%F*ZYL.wYh'b\ {ЯP45Fkj!M']SY$ɥ0 TMhp*!v0MMi$ewjQVY K!L?tOa5O>[K/0Yjjnl0((wMa b,]p=NzX\*wmk(!0#j|2F]Dpe2aN Ėu8r=,>utP!AYEJy`! y2bYЉ.5]L>ش SČ^c&8w&\g;TQK[zSIZN% ɘJ5ޠu=j?k&jմ*s`gTsg>4)K ~^JfS`wZqV /7z~6`u/+]# AD&bI'(u0"ZIK Xb5ڦL}X⢛F D-d4`#ޔKBBT@}Ģ2pEs0\V}gfŝ*D{hCy{iՍ W2̮es+\W2̮es(VR3ӈ NF%X)Di>Xa)f +xh$ b:C+ORzR -Hҏ4q%I>V(ycE*nVm!"/Oɼ U_/|^MCj^+҇ܲkGhޅ^??VMУ8pnӢ1r.Gd{.j,MNU%ë)B(&! qE ]h]^`SLUw4Ʋŧŧŧŧŧŧŧŧŧŧŧŧŧŧ-$'ƌ {4J&SdGBdh3CH #^#949TM(c(oK(ɖ"ֳ6b!N tb\MK0ʒvZB =j?k$8JW =ٍQ] V5T-ICR6x֝D w!E|Q=d޽R*UdրIifOjMdeMWa%wGh;C: f ӳ`v:Β3F%zɽ{9Q{W=j|Cھ!_lCPx (@ 783V.0Ss8. VwԖY2t0R! tE`,6+7V^HI =,BTYpD7&(I!jKfR٩lԶj[5-KfR٬`^YeU2覅VUn25kz}^_W"C e=/fmCJðH{yM)`#SǯHDU,O9}_Q3sKTH(1"0,2a(]3xpՎ J _3rocxV40L!: Ӟ (y$vo_7WU|o_7WYooU%\HQ@u_ՀZnA19tHe66xj|ھC_!Q!ڌ8jBjbq-)N=*Jr*RmI:P4pOMg7G?H@5J"a h%kX^ ׎r^R%Pda!펙4w44&7t\L+ fmeK.Nx7[7[1U V0B_$ ulٶAkSnPP%% DV.=(b!=2KAPWI|ޢ7 iۆi!J6Ԕ  ~O4K)'-na#C F|ލ9 b6yr4tPAh5(T&p f[ӂ(m5W\T ̂xr *!* p)E2e^Z?(Ѓnݢ^C,$$^)^&2!1jKlc[hȳ"VnM[[<ɬ wxH"L[Xy66i5m&Xu֬Ԕs`KlddBl^JL.:I|ޤj5EC/[q.%~*F[ B\)BKAX;<(d\Dǭ2f.jsP*v}H2 }1"[/HpADΗZ A欧R&cjaYӐM6CW ZuuX-A#]s1 Qͫ98M{'M -,SƢ:X+Oz'|޾ _{=Oz'|޾ KRR Sİw*Cߤb?bko 'YYlZTゝUV&iS)>h&;Ud+mL&LPi*8?JFm7=OohQ+N_9 =8xD6e>oI"2ϵ|gھ3_W}>jϵ|gھ3_W}>ԜM)`@U`7h6w"13 #]+aiCjR)JTD7M$lчOZ,;N\rky5b槉ʌ֫U}j_ZW֫U}j_ZW֫U}j_ZW֫U}j_ZW֫U}j_ZW֫U}j_ZW֫U}*̯S;"Ȓ ԋ e%%snNqٴM4M4۲n[J{Z,,,,,,,,,,,,,H G_5Cfȇ5oM}|ϼ(&<-$s? ` 0x= _<[y_6S@ 0 0s>R<,(:U+4]Vmk]CR(r#l&l&Ywf7]ٺvnkKQZ^W>>>>>// 56`wpМvw]|}Q!2 km;i؛Nv&ӱ6 i^_Be'yC(ګTLss\/).BΠԗ98hgL_4ӿ{#T \5 AZj\bV.DVY HqN>ݺOo/<(V +\@djEym]VptTyX6߃bixM^X|ov('(%xD5:͢`KR+,a9A&Nmް:u.-YS]8qzi e242o槤{ڪYNkngy ^s1 2)t -rcFp~eiCt]]m~ h{+2J%W`p PHpzρ>| ґKAa]t58uAEEt^(0Kqhy^[ kaą uqjΧ,4|yGJ`]iVe`]F9(o*ٔDW e׿/U n"S^=PC=uY|qscp\g<KOA"(ɨ~viS@)gf=ٔB}ӗ™LS-Q Ґٍ&Ǵcl{Mhi4}aӨXTִbV@q9 Ub |z XO4g̃)}oxvi6i Dr_!s!j^%m?Zp^_r򬞞aC:&85gˬ3֥Eb^!֓#+ƽ)wn:MI7#!j*ʨ.T;\o{x(/pXWYy~ 2sCR[K_o-~4xjY:\suι:\suι:\suι:_O+!1a AQq@0`p?2X)(ڳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5ҳ]+5҇bzP'W\  xÔ"7X%D''ҿ#_k4@ ų~L84\7㨧¢!C9ܩ8m”,/1BȄLuj1qIϕ*?JiH:%ZR[NlXs2>Uf&P,g*\hR6~~Ogꂓ8J ˓R{CFCbZq`bUdLppdFKֳ@0iɪ34`W_~O'yOO۸%#KcTЩSBO- Z<)Xt?l;׀^x;Ќ|; ˎ&+M/zsL _ 0*(8zYk3fuε֤D$0C(4}l"{ň /,/8Q1\zgQ;Gr>i&\]޴lS .Hh!t C-=K&ÃEB, KJdnbWT|jb$ ?&$&CݳT׶c<דέ'Ű9T8gQr?Puc8;QȢ-2cE2hwJVJUZjkVZT2f٪VjTO˹ce94 bkڐN' "D+YfkJw>Zc:#€N]ey£q8gron!h,}Utr6JBrI&)JRR><CIaLTE(hGME0K8Li,L^EfcH8'*H`gmݦ`BHnM0uʑ@~rZ qg( AʀD9FeC&#pU%di޳;cztY1ӽf:w*vCYƓ;ׄw^޼#xGz;ׄw^޼#xGz;ׄw^޼#xGz;`r%_+!1AQ0a q@P`?L8҃0`4Ç8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pÇ8pL`x^1 b$-P ؂[?Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,Xbŋ,XbŮ@W]HieƆKt#.)O<,u XD'F kdHEΈka9 8 .`$5?mQ_6 g4" Nh%팠Q0_]AU9 *tPu3I:&s۷nݻv۷nʄH3p ⵛbN]h` 1PqHhXE= W]F-Uc>>>>>>>>>>>>>>>>/&oq c}gsdV^ilOتU!wxРtU^[큭@da]br\-Fp5Ӱp8 #b͋2@W y7A2Ss+ 9f%N5v1=Qp]pQCrr!;pڄ\u<9 g~O.OpE0WzdV:EC&@gW|^?~ *U6,ŕbz2bQJNjteX #i"+7"t<oPpug F7IIiT尉WI4֦KDf8AnjmBg:_f$$LBh a!CpS۫aQHӤó!L!gmXԙb̵ee4s7FSM?OhHJۻg( un_C_τ93|Ct M;F' e7VuVΓQ\V"7%ʼ5C PsoY ពnS|o@Bԡm|cv[Y EXo6"[}<NpLOsU65Qb;X* ȨA-F 3I{DV\ ҕjueQ>CNjք]3t4Ʌ~uX r>N9@99 )@t#]~o"Yn#Q!p$גk9ʰ;A x'|9&v/TYv,&2%Ua*c%.t9`9d}qm TRGA.&#m|/)}oo4hѣF4hѣFmyزSm^mJLa3+|:CAYQ onj:HãE*&⪜)'.`/:[5;: 5M? R68X?XQEvmau}ף`V ) m#zÀJ(;P"alWyt%]ޔ[BV'/ DVV*xփ TSZ 3YdXF^qnQ@8%鼛\ GZ WLٴDI toŀ@̈́rQEDMvpF V[A)=U_nj7_Eݢ0 vaaR5@BX;G<3ďع y@s\.2wW46np%ARf"5m0C|˵ƅtK+F>x~6P%3`-_N\S?_!B@ 7rϹgܳY,};DJ&.IGb))^ Rf|p IN]uJ FNj}Q1%_FLaw? :rh:`սSs()S㤾d29]"߀" mC~hPZ=)h97\`Y7akͭa@yFP"u4gIIrCFV$? Bj憎6HLj븐BРld KR.\r˗.\caѴmV SP<Ƭ0U C[#M8$!~5`A&pqXm =̀Sn[1Ҩ?E(Dr~%8"MC35`- _|7wKx£jo!r(ev1-zaQ}.ӶP I}ݪԼk$wtbSE ~Mp(&iNR<<{NE};tr tG/H7 7)r}I$(5SK>H I2'9 X5sFThY74^DN71ht7j*U||[/@X^%00E]2yS &H2[%-b'=Idasb9Q!-8''`]jqEnÄǾ|v |6lxyPt9ǒM[5bi:(q+Bx:O㇦x m#tYqp$ .jp!g^.DV^pV`  {XZ/<Hfq؋!5 <(7 e['L [uXvYdDUy8eEJr4sfEt  snvRxvjQ9~@2WXٜMj  Z P&kcn_Z`jĀ5^R" Wx7S*8;zm\w\!P(ofpuB+#(+]! lnIڂ7oF %ѱzcG a}Vqǔh)o95pa&|~q M L[MHgtS?˙V@r'b6lt[GO&83b26݄_$ڶ0a#Eiy&ۍB7j* qRzxt`\T clb;TC1"5ޟ)ښgv7 g$U?NA`s{E5Aq>F3wI鮠8yH?0i&' `;x֮f('.gQv,NU'U kƘn7bڝ-0iDU =gm-3\ G`>m\"\M 2ڝ %b4,5sg]=vzg]=vzؙU5:k!?{pZp4xgsϵNóB4:@/ͽ،=1ۜkF9LY +x>B=nԃǜb' $H&s9%ϝ|"Q;8LErybM8.zȮ8r {ֽ%Z 8t{z5` nUŒh;`/@`,HG|gywywywH&Q"£b~3Hw$oǗ>gܳ)MnH!Yq%lзo\1^0LaC<^?pk#@WP -' 1]?‹0&anOS>>>>>>>>>>OfĀ +v;_o[a*o(z.:E~=`0>jwk-#.'`7 y-~3Q2؝GP9eA >Tnqu 2B@^F{'8\j`IB3/ĜQУ x كA8$`l(PB (}=#^d'rDV@b~AkPNl̷@:y*(PB  ꚓEXh VD5҅#!ytDpP blrDZJSk/(A0QTS8ȫ5=##th%8mIw%I$H"D A@^hXiq8Ϝ{=|tTZp||)hF P4T,2K|E5@ M!Ji%ʻWXdPD臨]v-) ]"wWQd @.B3ֹ?(hVPo:Mze1- 9$Fv8Aï׮Kyd2Î+R5q}&Ia}&Ia}&I`Sl`aWonߋjnhBy4j0|BZt&,80 ݩ rZzVZ<1BALjF dnR(8 %FgeatbkG!Y[*ߞ;Yoq>2#NO !J١P57\zQwU: mEmU)A Ȭ!VG4GLrG\5[Xi3s\FG )s!^a,h`ҴD{ T@;dSJ6CNI/.;Q M zybW'O3~2(t;ZayvPS5.bu 3+cPkN vy&{&>kglf=+ IO_ђK=IIPGjճ"AMd*8> Jpt/S ]`I'ĥ7ƿm]BYDBZa$` ;8pÇ82" tvYb@Aǀɭk+rN: BAÄ=Rb& KYKA Dac;%{\V7pc s @ [HaC}2:_iMI VYmC E>A'{W"'Pv|W^S`TRJ*TRJzAmB=L5:Um]'qHM48B}ih ?,b7tQ6)g3L&}>DϢg3H"n=ZjB#C k(" n1*"@(9 3i$r#؛z$Ϗ{ǽ||{>=Ϗ{ǽ||{>=Ϗ{ǽ||{>=Ϗ{ǽ||{>=Ϗ{ǽ||{>=Ϗ{ǽ||{>=Ϗ{ǽ|@@muUIJ[ ;TIpt?l/Lgf zύg~l߶|o>7ύgpו S/Tg}>l|>c1Ϙg}>l|>c1Ϙg}>l|>c1Ϙg}>l|>c1Ϙg}>l|>c1Ϙg}>l|>c1Ϙg}>l|8'x'tYcejZlݶmmmmmmmmmmmmmmmmmmmmmmmmmmmm endstream endobj 89 0 obj <> stream x{uҼlȔR*dexiETT)ڔ`ZR)"Da64,[K,S-[cܾyܜ9;pESn޷\=PV|Eq@+z8 q3Qu5 k Qgc=Cz8 q3ġgC!=Cz8 q3ġgC!=Cz8 q3ġgC!=Cz8 q3ġgC!=Cz8 q3ġgC!=Cz8 q3ġgC!=Cz8 q3ġgC!=_{+PE+~t{@=ͩ^ Tig{/PE\vP@䞟q{^yo=h3W{((uw~rj@G7wJ@ƞ^}#$M=ٹ'{~<y͵)> ]MKO3:ʞy!TȽ h?Ka@ke=?|g={Гq=]UjCGy}= ߷Ƚ93tG;$G=t &Gn{ГInvtSI뿸cU@/ʮW(ig=(#rzP~u*yDWATOwV=:<̽ hѫ\%]Sy^s'T}S roکyޓ{JMʽh{F󟗹ttHmCs#{.J{.n3H IBC{%"/NH鹸dz@W}}I=ͽhS _ZŲCr%<r/$\K&= 4HsO$\[z=w~@=բ⦝s/^ is heGZ\mʓ5UE4 ѦI:sfݫN{3׮|ܚ˷?XgXݪ^󩕅^__ 8`K>B [7cg膭Ʉ\Z:bz~6z#zw/zz^?* ]1y7#Kz/zΘ<6 ={k =Cw<6~kօ =C\}wf3tIY=' =C\{̌=Ws?kz>Ws=C3ġgC!=Cz8 q3ġgC!=Cz8 q3ġgC!=Cz8 q3ġgC!=Cz8 q3ı!^zCz>a!MoHϋ z"8=Cz8 q3qmM?=heюծ=?E endstream endobj 90 0 obj 2405 endobj 92 0 obj <> stream x\M6rWhm߈$x@_;Hv"*cN0S_FVgI,bn/a1!m?oR_B}{>^ʞKjuk%ﭔl P'v@x䗾4{\^$. ]%N8%N :}s˰TɃZL'q -%ޯ5?3^K H`IҴ.]75q4]o'S}7Or6dlZԱF- 4(`+} ǁ(m6LC*ȘEt=fIeT 4Y}%\-iw pkj9 %uɢy=Ee vDP3Q6?9e mVJ'PuL"%.#ZكA)ImVh;1x"I$ms$-i-]9J2x27Ef:@H;Ay0 m~l5OLΓv r`=X W^66wM6ODxMx'Nx)$Z0vjl} n< Y LMlxYֺƆbUflթߪiOfD` PŚ[(&hq$T\ZKMSZ~hEQI-Fv@[d%-q>x@Yn _O U! =z"{^;k;mu#pF-[F#U-vZ5ҫ`yb-LN2.3Z? E@0 @p*liYg <"Sq?`|n`Q.ήɦ8HpZٳ%FxatBi8mnd-7vutln~m>\.;iYd$SbYSRS'ʗ\nT}I-wSL'ЎA]RjyR4]V#U1.NLO9:xc'ybO/q=CV|aՎoߘػ'QT?8UIs\Vpu Wpu[Dk'*1Fs޸έjAFjG֛n5S?xqSNU5]p>wܝjzj*hS՛b L>+TGP? 0@ҩ]`1rı!<(#Aҷ Rŧ="r,m{d5HuFSjpޭKdCB:rhezWR:@od_4"om*ϦQV:Swe͜@>t³{2?^g&'Z~q܉7':sSN .U  KMZ ˆ:˜[+WM&֍oǫK `Zd f]ހ.b=L@4d^^C.M^%iN*45ࢁ: Abi [9g_ *(&uܤ̕=V\I/Um\CyB@rHԫ2Z$l}ՏE%jD,= t0 \BAkHqٴE,~_h'z]vA@l`%zˮ.>&@ #T0%63$lÃ͗Ym0AS }i+6'V+Ag<(։](X {T:K!)[]⪕7PRS}s8%@3Gy dp(#  f'^76T`8vt$&gQIhҐu)| SRFjo<ҭ(/LP~B*s"U >j5hHC*6鐨6@ULJ\3Y#ov{0_IO]KKY0׈ Z)oߪ>cY"DoL`J=E#)Bbt0CaOv kX0DB'[|:PP-$BZ|(8|.!q^AK^bqrNfSܭk4Bg {<ܜɺ=~ֺ]?V|X&,)yySE&{ Hu4ڊxA᝴=?ݗO"uiFSL6YOz:kY@5",y:\/!uOV}:~)XH*eI ipU8ؓ"Ȳ.O?53Oa.ܮJ~= 4%l:ĨCq.&8Q"IVW"ѕjIaJ9jy'L$fOV &J4oy:<>e%ne6ٸ3NHK ^\ñ%]|BOo(\cb7>*S1ݷ^} ?+k͚7^lgW[TbP+/${At`0K򐒤ZBQXɿ(2W= Z Y>Zf(֢rsu^*["'WZ6ä^x<,j8nؒGC}43]3j2t#рxcVos7jh4k$}Df5JrJ~O*ѯ駰cxc a]ھ|~R֣֡vqk뇼8ƇǏ17 ]—u3PB?Ƿ)!L_2Z78Ki_o7Rq7Z:;oqe@p %q5~؏C""  z˘eHBD9<S x)ҐU݌C n؍)Jߌ,~oAZڛx>-0L(j/6t|:Sx%ߞ}zvdR'MЧRL7q{+ *+Vk4'Pj}z=klL#_│9CRzh?z& }:~gtVy(֟ϟNKVU=MzU%/Laa 33y^S!tQ=ݝ"QB)HbIO2\;#|Pk8;F  yx:ߝ ַ b#>M6hhuqD_]\{a[!}Q.&<\N_`ѠrO;/q"CpMmĎ=Uo[#Ej_㹹Cζn=E;nc,ާ=ߠ"5\/jk.5?hH{k搘gq{$_k xQt [>Pf>^D/d4u!fS7%7s߹1|vl\|BJ4E2LVOf+$L3U̼5\]}wa}"{e%*P7U]~*'?cOi0* y{4 T#I~ZeFptlQ_%:* > stream xxENBBHH^лtA:Ҥw(*]zPޔP/(( /;Ξ3gl&ܟ빸3<{vw69vlذmc͛ƍ+_|L|}}ʔ)\%A4^H.yiҤɌ3蔗*umwcϞ=;xرcW^@̙3ngȐ!K,+Wݻ֭[t>2jozXN%19MC VZW?bco߾]hQ$ݻ5 4:J,50 jM1RW0E87SpA bDpHnݚ/\HU=~xժUkΞ=TTTժUΝ+;0uT~۬Yj]HUp`` _xǎ|'N :zqqqt1cƄ;nܸٳgfÇ˖-kڴiܹ|||RJ 4… :]G\vmҤI5k̒% u9Y|TlY~ۈ_UGʕ+oҾ}{ucǎ 8B 3g)ڒ)S%Kv֍Ώ4)r劒NZjTjXXXŊ̙#/ ;ze˖- &&RJ3gμsRG9Y~YZ ٭իW(QBF710$KEFR(bIlF{ݻ7ƍʕ<QnjsU%[dWoߞ0aS;o޼ݻw駟}gtGGGc$UTYdV/So7{3SOѱ*. iw0i.yүY-$nb޸q&Ç@g+_NCvd_/ɓ'u_|AEtҽ[4VN*Dgζtj iqqa[~[,XO>[lHϽx"\hуj/]ȏ*Hv/"DŌX~wvXd?RR?>! !jJtܝⴙ|K&%/_NVsg͚%wGzX(L˚5zP|W{O"7aof196\BYr2잱_+:/;&g"cK`͚5|a tZr; M4sTrCN{.b12dȠ.uL;/}8Fχ~o"DqZoO/2mˮK4ǥq"kNPeX>}ÚeWp5tнl3#E 9j.lF{G-ӢcxE2{K,ɑ#=z]B/W {3SB2Sa N˷H5ppDoD:U)Alhh(jÇYQ;wdSg͛W?;}E 2f̘=zdϞMHHp 0$e>>>|.]sȑtAgmۖVW\0`@ܹH~C:K(PrhF#UV-}W_}b \r-ZPwcN.%$#-|mQQQt8gΜG~KE'I:vuARڵkŋ~J/類N"OqOJ)COWSv :jN9( -}0M8ߐT8hnrNl^*|y葒i&ubg\ H,z^ {S[ƆK &39K_KK料O~)StrB۬aѣG S^eYµσmmFWo;3{lJZ]_t.޽NA*!]~҉yc$ok;vLp<贘PDž2dG ܳg T>ʤ*C/8Npɠjtwݺu|+||$}OtZdJ \bELݺuW^~U 3ٚSϥaofIvp SILr]4Dp|OFA<,,LyD*qСB%| \]\:|lok@w|;ӧ{p}ժU|(yǜ"5kHnf|Ut1UL2|Ilje˖|V6PW,YPVwz~)nQC5u=ƴ}|֌3;/3rH}OtZd ׯ__(@PF£Y{1p4MN=n.!4V2_Ubfnf"cxe޼yU?^ eҥK'\2_ŋ,泄6s… 2?? t;&!`2Gx7*TW5p@781iyD;lH>}t"sP\ v}5ʸ 3]aQC5u=+ -ZS1fLbb':-a 'L XxPLÆ 5٣do8tϥaorqp SIL3sp=`l&2!r+Y|̧~$YfYB{nWץKC,={m۶O[ lRy5SCisȑ9r;Dc",RZzuy󋆢VI???ͱ4^ҒSntb*CGl ^ΐ^SR=촰/N=-L=eP i{3#Itލ^  Kb 0q̆=z5jԥKXpaܹZU_2&&@s, 貑ZpLCtu֩kXl2]bCH~)RpH'r'6a ~)vicfIvp 30K_MvLd $_Ny_%>>^kϞ=;qÅoi/|Ey_e '?vct\f)'O*ϱx{{ytҧO K">~]reͱ471bÆ {/qdOH!U]^Kl nGP'c{bvZpbfFǥg{3d7DpHJR?V }>,UKqu+k"IߥK>J*/\ATIW>)Xj-ZouXH  $$j 2ͱ4kԨ"E:tYObieqסi_J6D#<Cذ6zkyhfIvp %Q]̽[f"ctW%)׮]Zf .w~|jժ̙\B~|:yvw˼Jŋ~g 'O DEEi}W*7nLv45l۶M(ƾRs, Lg={Ν;Te9kN?~\ҙb9医Lc- R!2ɡ9Mv}ѳg>|aOlN RL<43566\¥g=3c -2sp4å#e*ya_>+Ou͚5S3f}i˗/?|(,v|]] '%%EFFe %K?j& ׯfꥂ_X}:u*˽rp2]!$|^sreki -<~XS͚5w$ {iaÁ_fd7 i[3?HɴWge&2KG|UNa̙3Յ^*ܹs[4<ƌӻwe 僼O&uwiԨ+UT9r$0+|ʹu֤?Kógڶm3)]4]Hשt 6lt%tQDDzTX%t^sth(Une֭YoĈTQ3Bj?e-CHAW^yeРAn:θ4/"QSGԥKR]Yj2 {iaÁ_c%d2E2~g"cxƪ䅝xS^葉XBg9GzŔKO0ARJ,OYh^|c@_>{Pd6ϔ)]Xo—H(^:H"4&k ^zi C/Xk >|L *ذ6z{hla.!XwgrƗD-iuLdXK>`gӦMXBCf: Z5Ѕ… '_׃r{G8qN:C͛WgT+/'?˗/CgN}t/t ¿sSD &ݼy~ 2]!D. ^)LCdpW=  7?MzbvZpRCcSp ƺ=33$:mL{\3dwkF~R$;p1y.\0sLE"E謡.J>=*T߿ݻeoK NbҥJ*Q?Pc5?N%?L̔)Sʕ+I2,X@G9Y_`ɬYo9QoT^}5 59y뭷˨LŊCJ:cЛ?NqisK"aܺuk鯾j֬YHA4fQoM= c% iJw᯶h|iBќiXh3ќ9s۞@Ӈ~ŋG^,^%0_{u^+ZhLԋ0HK`&Rٳѣ) i@ځ&BdddNF٣G\r NI0%ޑa8\ЕTzƛ@2ew(Q=n8O O<2d??>}kXHxi9srɓt̞U.u;^ׯ;;w̛7W^Uok[{nppVN*X~W4hΝ;yV?Oo6:qV`g{e <G0rWH >=66ŋ涕 0$7eϞdɒ$~~~|zÆ -u!Z@?% tƏlɶW90eɡZٓ.]:v*Uj,+W̖-+Ph'O5V*UjԦM ŽgΜaY7ol߾=د51"0s^{϶l{ڵSKi_gϞ(PժU{o|%,XjI>}ߦ0<..Yf_}PUp=E'NXX13$$tѼhVr׮]*AAAtH׮]c?,x{{_rE]-[la:P.5*Zɓ޽+ ".uثo۷o֬Yiè֭[J˗/w166/K,=zAHE2 7:Bq֭?˗ .\pݿ[{[PE1rtgڵYք ԛoذ X UyfvFUrƍ!ԨQ?jI&=g®\*Uԩ&BJ>|X]ĉ$/&[9sɅ XnLL۹sg-')/eZR 9rtU؊"= ̙3 Y 믿{?NZ?~}dc)'̌U\ c*gI}?oݺFP Ҙ{}P PR Rxq6͛gd,+002%?o+u )SÇ ϟgԩ)~cUV=zSǴZdKݫ| K`>kZYtg,Ec+W.%b7nXo޼ @4i4zFZ E` ~4?~ŋHnݺ$(t5߅QMzE-L tЫ]'OYǏ~ z֬YX +_ ׮]kOW_UŤ*:)yq'/{(؏BhRN{1V Z9 u sXٳg]Dwf?˗WXѫW%K#ݻ7_=(B,Y$%F|a}饗ۻnݺϟj.M>jHy{M< ]7wx#008}+2RLܹsPIU4|FARC?׭[ wdƎ73ԇK.\~-*RuH$O+?:B NO>? M12dP5j|>Vp}R^xx~] $QX1$:fx_{4Y @?4ݭfQ9ƒlΝ[ITI W~@2dC=tȈ#Zt7F6:mJ~ k׮f7pI>|H=*ą ͛׶m[aƍ˴@&#iyQV,cƌ-Rz*_ժU^z,?q*ǡʹ]g[feΝ;G37KZ(Ȝ9djag|gJB oXhVt9mWrs޽"y2dɓ-[Oki5kuuXd n+]ve:/.pBVZgK꿧ZdK43f +7o^?cVhѢr.͚5ck/߲ܫV9 g'>G̙[i:4ŋ;M^߇ںu+{tN+V )Q0ehV)䗐3gw!bgvZn?;5tuoҲe/pС… ԕL8QeR,|щUB [ 0e(QBETWe8` ,`Cߜ.xի&ӧO?N'?Ա7nb~%ݽasd2d_\p- ¾}O`x=xsP!G۴N+qY%$$u%K)[,s~T_w77ٲe+Ydbńo(GU>&#J7\|d\R^5@H`Y,x޾};NAxx8igo5ʗݪN1r;wz8x𠺤{}ػw/2r4/֨QC}1(hժ12J+t]re\~=߿~~xرcRLr+F[u]n]v2f%Js߾}mҥA,O1J3?pႿmll)3X')ScH:u`sD ܹݽ{788#1V)XӦMӧOrSfN`I|R~p~:Ȟ={ɒ%i=r3hydҤIŋ xw޹so~*c<&? .~w Pİ ;=ѹ~/?F|||pau'N4Jl4hЀm8sLa .\%)fH~9tYkG,.GH؄"~<Ϝ9UPK?|ַ~[Ju:uoB+WN],w{qu9rЩY%-cj;Ɗ)c9;bQD VlժU:%v nݺJ:lܸm+&Mb}U'9s,U4<|P)R`„ |n޼y)cCz תU-X`L޽{W\a֘1cdErR)gկ_ &J7QViwRfJf}$cWKvsɓYz >xOR23ڵR#M4gر\O\]9oߢEX1NHP8!i@OBBB^6m~!7oK,K/tq1~ o&O|sαtkȑ]ab0jѢ,ooon|ӰaXVΜ9D *Xb͚5Ͻ}'OĀ{ncZAa,Y.` dĊe̘QR=7nVȔ)oaϳ2ua4 &(^jգG;3s/_{wXVӦMY:_'|W>kZY.]rڙN1>룏>⳶oβĊ+Ĺs ;ɢ>|21:ƴȚ5++sNeS| ~'z1ji7o?^ŋU0nݺ$6o\IL.P}tt4M/jtfWg| K uq,"-?ՀSN;L},C$KvӂL)>+%w%]q r+Vիdɒ){-Rn{=~8,,LIQ_ƍj{/s޽ 2(5J~+QU{w7o^Ssxx8?/K~ (TPm3]r?kE=ҙgu4Sc«KI19e~ `k˗ZHHÇG6ą ͛׶m[~-\qƬ?ߜՁʺKkK.޾}[r;ջw^a_[lI>t Ā{&ǘzu: pɥK6aÆpXQw!}vL~֭e|xqϞ=Y ,Kg?ſ_uJ E# {9Wf;ߣkߍ]B&&1Ƙٲec/w9/w_6Y&Su:,C+LsLB]ve + '?.\8bĈVZ ߂?q{Y5Y5s/5 u4:dȐɓ'/[Aʺo|կܽ{ 9x`N}a)ʕ?x >>^}21;ƴ?B1k2?xx?-<>JL7o^ᝑ3gt%_|T_lll׬Yv?'4i҄␐OjiѢE;uD3:Z٣T~]\rQGO|~uGKJ{ nc_5a78̜Sd',yL^pʦI&y,8Oc3fPDiwn޼^  msy+YxxzH",^x[N?S*UѧOO4i҄ӧ{رhѢvxxZ i1fӥKռys3yx[E'00… ܹ81c+Wx#nʵ1OU&w`0}C,W40;'ir` id+d ,2VՅX$e 1(0HL ;XT&cP`` Av.LƠ" A0-`P]AE@`Z 0 @ua2 id+d ,2VՅX$e 1(0HL ;XT&cP`` Av.LƠ" A0-`P]AE@`Z 0 @ua2 id+d ,2VՅX$e 1(0HL ;XT&cP`` Av.LƠ" A0-`P]AE@`Z 0 @ua2 id+d ,2VՅX$e 1(0HL ;XT&cP`` Av.LƠ" A0-`P]AE@`Z 0 @ua2 id+d ,2VՅX$e 1(0HL ;XT&cP`` -l 0y9" 0(st\r]Guav6(0H'$4죕=?lP`` eٛ)?lP`` >9hܺ=9+?> AEG__LZ᧻,cHooN=%Si9SJ!uy&׏e5i݅j#u[HHh \R!u]x `Յ٠"#AZֶo~>Jgo g{i=G囿g-Ajӥ/lw3O5;N@> AEG(]~_Z,=0(hu6L§z[kE} c68U-\UpHQYvwmˡ\@> AEG&oyN7̙^.@,(rVn_khUK-t/_QNsVl#&]PQޠy{<lP`` K,ݔapHM+Ӡ+-],?^sXm3GiE}IEgm.z a2^$_m@mnq)X}$H3& K@7Y+|o>gVզK_eɞSb-CvH{S]zBKZu^~jO˖q8I۸l9?st\Uwra_>/gYY8ֆ}ci|o>nb2b.;e5VۻyݶH ob6dd/'"l)&.;K]^w~sQA j)iN=Av?NZ6QSl)u훟k~ޤow7$_zo\Voj봴SElś}x=[Id|=XIGDE׹Ofq]ޟ}t lLz烏֮ߵ;n XDN%AY AՒ)wQ;ʙ~WX5V`>b-|El%{ekԪ3{ZY.RThаp_,%ʾܢ}f.ӯ;t=Gڐ6Z;7+~+qv(0{~zv.#=#)8sxWsoDvj1{V|Trsd+p{'<Hg+ɬnGS|o(t)_R#|gd||BkXW2EF@g!3,L2Bו, sVBX~~K>?NVYլK\Q5R'uI%M,]TS,oϠ ܡ>q.?esi K'IdRXء ~5 1ﳗmɕˢh7?ɈdQNEL_bxGAYbnnJZU;V׃~Dr?^chR էpiBIjC3.<&FFN_ lޚ݉Mfϑkr/=N!_椋qr K6oY;OܧpBHpWt8F2AvKmԪHfeϙG?YV !QĠ1 ,ӔtaKV?cxĪmG2k=[af7`~/W'\ƺvgџ,+&..V%eoԲSO6Yn,}|֨*-?v"V 04mK]D~(0`Z eX:Zoȸ|X@M]AQ| ݫ+8z K?pO[~Yo8PJ-3o;GDF+ _em쎣Hn5ݙ,٢jk0{烏e*ʲhQ}D9]ǯW ?AvիcF~) tnFeqOnS;ufbXI $+qeѢdxQ~| <?Av 2fb[5mӕ7iE2^ЫZ+Q=YYQhJH6aE[HosE5o.gF~/(0`Z R2+^*((Wn=ҥaYc\o_n#>}Ods[j#>t3vIsRJR*|Y-f|l3}g/R+oG& id+HoI^u 'Ya<6l)|,+}7GCt;| ~0-`)FRB4BS$C=Gfj]{ wQ ԟd٢}=@\>>3>L ;XAJ~I9mݹO\x__ +xMƄ|(MZw ^oQ\MIv[FU+_ iE\7Y?3+󩒈1ԫT'{55%y-炙e 1(0HL ;XT&cP`` Av.LƠ"l(A˾8Ԩey NCf]R{ɞ׬vd+lhP``v'h}Qa/= bn AEJf.B'C l0X$+uX!4ӖnJZPBt!K1`R]m ,V1<~=Ut׷Z߼^Hv,Lj2AQeݩ/˥PSvsE=߰;c>8uEJua5(0[It_7Hnu[m@ș'|.%4,IXhGLG%U6S7<~, ;XTf[ejtkYK ּ]w#&.ۖC?|J%*SK4f*/#ޟc7h5m2y 6Pe_fn:p}1((W Jua5(0[Iv)T~z[\?˳,?`o@ WpJQ %؆u0ヌ7V`+2^\4Nu aa7 ZLub꯾Ηϒ=Na˶u@Ә\w&*EKco4ヤU7V*UKZ0[nj<(I]c,R@;t`ͬL)峯gnDf9-3>H aRuSf{T/i9 ,ž3ɿRA?k9+'tS_r߃nfɮI.(e[ڏ/lI7 ;=̨nr%\u{N3c`Ɔ0yؖC?'I X ϼ/Ÿ1)ԁbt]XimG|w@Ì*4(0[~/WPW$i>gYy |yw[ei)+=GvPђBI>ȻA`fT*:j%8re^1q|}bp-I钙D24,? 0:6K/h㽙Wm?ֲCQt>>!Nh囿qrmb] ,VrYaSlXaޟ_ϟsӍdE+|Cz2g~#? d?e*h`//bIB1>䆧 Q]c먍LԭhOw"R5d|[YBgi-wƆ$cM~ ΊA 쉱#nOm [5~M[ "Cao~Rt! ̨UuF+Oti^*~lkk 5kMN৵ܽd5]R`~w ]`7w[~!a~ua+4}֕Bf2(#?JtXU\rS+0VW,ju.ZçgIP`޾ۀ8A. ;g{J""C+|3nUju5TI//^*>; }wcvWBո$JdϑVbS:t]d} ' ˘70((.[>p/Kj^݀/?a 1~X5ʽhese?OUv} {'c VS(/ZNj-wƆdM~ > )306lle*I?a+eectިe>ߟ<3"f%rnlMQ`}Rr0bl$ i?-+}oȸ&NcY,} Z+K+T__~NWܽb5*W)?06 V^u}ҿcad{N^LKdQ|RL৵ܽb5t X'Ad+TWg{2%~#?d[CUs9=uE5 +[ [tp:-'ehMg 0uK+0V' ˘e+b5i݅J\XՎQ (Ca&lMW~0-CQ]E]Z垌~+{@UPo_n#>}O&>>;⃙K7Skw4w-N0şJywDF3B[Q[LYL'ɏ_1/Am>U䰤d',G_8_ةc6l ?6 ,l&lH=76Hy ~0-CQ]cFRBIiK{ "l+X|/PFZD(lH=[)?! ̨UwҺs/Ch5^[$xҷI.5Rzˎ_~Lϕ/}p9HTZ{ȸ_j#-W(d7mub21̳kc?c#L`P])ƀ{%[Nm͎|ۯ$-eK5;C?L^cGߍawlYN$~A1ߋF >R4 L (0 cG]jQTނEV;<y V&cP``۳?eyM?.ɴw KO- ;؊4U 3?ahֶK}*5ùJz\,AN}3 PZY׽۽՟ߤm~Zqd;>|U;rgՙc,,>W>N>8$G8oLjXC}U7p~7៦0zS V9_}Uێ.٘MtQ^pIpq{nQߴMWJvҺs)eXk$PN HїoTL\VB[I:`,vG;U.w,Xn;d;`4SsI5n|=<˲dַwd-r.lbP``n: Zsj}?k^;xK˰ίR3-Bv-^=a-Y^1% ut9c)%h"{7Y&m$Vރ[t[rnd+O2zW;eêdַwL 6.OBE"+Ac:[Z0)|e Kk9 1NbQZ9c(0HLƄ 4h5w GuYK7KnRƯ> (S۴ 64.*W >M}UjeP2-PX6]ʽ`QGph#b{&ZډXb<hyzb$?(̠"#A0d+|ԲClZMIYբ};GV.~sVlBuE+|C|+]_CW2dv˲(Go[e Uk̥)]䤹k)ePK=~Djl%A0[d+v3K~S ~n&m jÖ?P``5v } Puߟ<:6NDΗ |CAlWNl& WW.WxsE (0J& 쩺_cE5_k=g ҂ȝVbQK+'ZlΓ;)P*,c&_K\_}_  (j-J7ힷR31>W!F@x+T=dtFM ,žAv.LƠ" A6b+)IVՅXDK7Dٗ╅ԥ _f7sv)kVkN{'"BHAA 2 K@pXd0$,o"ˈ(] QG#72!;㛲S: 9WU֝^ 3AEYeЈd_?uȳn~]G:M  4~"n+Ak_Z&tYjqRv+f  j׉MGD?ԋZ_<[ѕ~Lrʄu{oEPv+f m{9pvhfiJ'mK__ SAp'<"ivFw^v~pq .[Of?|5E7V{`e(h3AES>;Y-/kdl~smFj%;tIkevjEŬ1a/;#tKos?9xжSWPvf ~շLl46հ{=椿*Wy${uuԀPS(;@EG *0,TBEշ 9h=ETjKb{|ݝ7D6T|Ǯ=,s<聿<qD7e(h3AES6ݑ2v̂W7Rv2Ə0T`X=%(idjZ||>8v.Oݪ}y*/(5T6{(}"K"-όVrU5]qcQv2Ə0T`X=%h끓>>oiѶ/~YνOiʫ=Lm:%TZQ1vun5nCLj&8`Uj@PpȡPv2Ə0T`Xm%qީn\1i+j:d i/\ä)vwNV-ٲ_coeD2hݰ//oNtN1.XA4j|:ޓ{g'SvҏƏ0T`Xm%ЉvL0It6vF-O .p_vRy헲Xī.Q& ʛ{kv)C*=[UWi5eBiD*0,RJJEتլïJJIݤ'~r);JI%JyPaSr3d,YďV(=U(AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+Pu 3AE(AQPv+L55# -Ə0 ?n14~Qp#[ a4~bhCG?(hFA-LN(=üyJX`biV\)')bQ,<@gb7~.\3 c㗗WxA*V5k,1Zjٳg pk׮}M}ɓ՘ &ԯ_?88XSnѣG7璛dɒmVP;$$QFӧOtvK'`3y9Y^q$M4l^^^7O?=6J֢N:vǘ1cG:v&v rܚ :4&M$6j=ZYYYT\>=OХ&Oy鞎?~<22Rwk*UN8'@%m6[\\ܺu^}Uըxyyȑ{MJJR$}]HHL&&&nڴiݺud}UZ5&&&--mǎO_DRnmڴiFFƍ~^o9ɕ+Wի'*UZ`Ν;.]*ƨvHR4?)?/m۶|~[[ttL6o nO h-T^4*jxʫqdYf7nܐIG˖-E2,,իv {sΜ9r/%_˗//L.YDf|}}weggM3f( l͟zUѣ]vbjj_>}T2''G-ZI dw{5z%W=쎭UVjmرcnR=^6mDIyE;A͟2Zʕ+L56lؠG'7~ӧOWIu;@-[f/:$ ؔ)Sj)%%En / l͟Wjg.W\zaaBycn^3r7^%x{{Msq~NFΞ=[nc w&?eo7n渗U۷im(ۙu;.쨯ZhC!Q49)?|rssٓҾ}P5,$$/pfpkڴ 0 5kLn֭[ݴei׮ٹsgIDFnJHH( l͟WO;wo8?p*z7|d255Uf5xĈݺu>|_|_ԩS`u?5kִ{Ȳedjz_{N`lt>s&&&vQ{˗/J˗O?v6M&ׯm۶w߭:'ŋ{k׮ݴiSBBDFF[|ʕ.] /TTI&\R49)?/={t5##cϞ=֭Smzzz}dɓڼNJJ]_XXXBBš5k\=沲PkU,}ԤIwZ'Hs^]P9sYfN:;SQ{_ ψvKd\Z?f9N>l0\*a,yիWqʪUug(.v4~4rH2z ӧ+T ;p_Ts;vx^Mט///1^t_*if]VNcǎ[n?8Yٶm-C VGE:ujN? P9R 75j$g HKK+WРA1=zT2d$W`2ze5jLiӦ][bٌ`oԩ{~.[nUڲev-\ٳڼD/;vнVzbf9^ri  ]tQ={ȤKl-TZ9NWxA*V5k,> j_SO=UR%5N9++';n=zصQaÆ9l?'h%H\߅hąR>VZZww<]c1eʔbg**if1bJ?^߿][+IT255U3q\ ǏV }ΰ|rx  wTEW A(QWOw"WeeeoYnݺJWX~_CgL4.[ Vf[nݫ+''G#Tէ >s3Ɗ%ڰaC-T~߾}rw}'!}.π qTCLo޸qcI7+D{ 2yN42?_~.,dggyyy/=+#sQׯ/v~eh JwqT2((oIƍK|U_|2߿]%_0B}fT13`ܰa]we88*M2Ew-(9F|A?S;^\ ͏ɋɛfϞ{trƏ/ܹTk?we5>==Y(2yl}fIU(^^^2[o~q1n=02EFF^vͥAAA2cA'^+:YWy2VovvBc+D3;Oڽ.*󡡡2ߪU>|Xgܹig잣d7s=NXbK3;&cbbdwڇ53,:.}1FrtI%w)^*`L[!Ey{qoذ̨oCaÇw\LG%s]t}p3WUVQ!!!*:cǚXOfl6?,_}t… rd 3wߕ uf"w7^+V|gv}z Cʤ dŋj+WzTܹsOʕ+֭#Lj*ٴiSEEEk7(IDKӲeKnZ}nkh>}(Wq=\YM6Mf͚­S*V,e}`= ݤ<܍=Zܲe֐O>]vڤG^UD{>aAp;jJT\ڵk?C3g/Z{vڌ3. *ٳck&^LߟyW… ÇUoDDD.]ve~}BFk{IWE1yUe6l|rEc3ڵkWDnYfm۶u_.ATTxD[޻wsmܸQ E*VXRP?s۷K.yyy*z衒=ReݩSmo۴i~͛7wU5&?` ͛a 99a-}Y_5z{q:,P:?x endstream endobj 96 0 obj 31508 endobj 95 0 obj <> stream JFIFC     C   S" otV{|i`.x )`.x )`.x{ whW;pqIPbbbbbbbbbbbui]m#@7sb4Ľa!!!!!!!!!! si:.?s֛tW(E E E E E E E E E F\q#{+`.,~[[Sl6$klFklFkֵ*ZQw}w)<$ rnH.Vt9 t.cn}R;yH A]z._q˼A6EY7DDwV@kq4J΀yS0r!^bb_nF 9[F)8F)8F)8F)8F)8F)8F)8F)8F)8F)8F)8@5v}t<=l]()9iI񄟮a~P]Gw=O? ڡZɡ{мWʬLu{i˦{`:C|=](ޟzp8R;yH$ n~>&\iY7\ p;C7 L_(ҍgSˇO2pv]:Yt.b$O0C2[zLJ܃ݡ;XT>p8R;yH 3B͜ϷQ<Q REggUq#JM4tҳopw_oQ="ot[1avz[קx"JM %D3-I\T0_yKj2hґ~P]Gw=O? f$<ߟy߾C M4tҳopw_oQߌm;"y>mZQ-s1~io_!-S1o03>+߽q%#<<ūڿ-?˭& yN>wvSue cg楯T'Yhj)hmَD咇 nh\:yÃRpIXZF|a'g>_}~2"wrS@;xamm8rgaҶpbnȒ㍗I=y1: .Vt cF7Ct=lJ7EO.< 0ξ}!~P]Gw=O? u-Wy!Yh^DFZc&lMNCJKM+:7%-g:p6Z^o;U0]MjhSEښ.v4]MjhSEښ.v4]MjhSEښ.mҝXeU[h(?CH]y,z16666666666666666666666665fBP' 8d Np@2' 8d Np@2' 8d Np@  ?Gŷ/$ rBe|'a8֬w/4"D̰@՚r}=C(|[[ ё.Mf:0"QAI2%*;1(#L|%*UV,^.׉.꼖W )8d$Y"HE,d$Y"HE,d$Y"HE( 2z(SCOǨW9GrP=Cz(Q9GrP=Cz(Q9GrP=Cz(P$*0j՟{P-"OG¿1[PLVe:Di"Rʹ1J-U iQ;c4~mԾ~CuSPpI[v-].꼖W @՚r}=WoGª^cklK<ՆT$7A5!ϝ;Um>uqQ"skhH%*'q<4W١@?(SCOǯZ(?CH]y,{D ?s/o540 z^%ҏc<4W١@?(SCOǯZ(8fKMԼ>:^xP|h8y<4W١@?(SCOǯZ(8gy$I*2zm=ehhV5+8UiܴMl99@qPrH]y,{D ?s\|NQQ xꏃdBUG_Nm,yF>=<^3Vjha25jKFR*K$Dԧma# Kuxv-n{'+ĩJX9|0Z((+<@՚r}=Q+^jdl: S%(<!曄!Q.ZP'a;W+Ha䱈y Y*6y*+iE_CbJR2jVOoS{fI,Gxi -ЎIOj=WoGksr@;YqSz* ICUEHÑ]E\;J+EdeLȆiPI`Lxi -eyN[6fJ9 ۢz WoGBhBt2K,$.g)??L:;|J=u^s0ą)Nrpܜ.w' 8]Nrpܜ.w' 8]Nrpܜ.w' 8]ʧAP)?fAo$Ao$Ao$Ao$Ao$Ao$*IrZI7Ao$Ao$Ao$Ao$Ao$Ao$BΠh,O O O O O O O O O O O O Ϗr|C6F#dl6F#dl6F#dl6C->#dl6F#dl6F#dl6F#d.+ !123a0"ABQ@q?bVI{'EN؝:/bt^轉{'EN'2N&vKm.]ivKڍ=eKm.]ivKm.AIDaVhVhVhVhVhV&Zi''$>c}>|$DI }yBNv?K++询+询+诡4F="$ j I SB_T)BI) }UY4 (iCJP҆4 (i$''X;_p*&TTD\ , ζ''X;_p>M`nu9=mS[$JX~>G`\1EY" US.OXcho튙RE"&VlNOCln'TU%FJFH\.w'14vh7ɢh#"i))Vs*ByHBh+*lNOCl"ʤԚ(N &w#DTTHg"Z̥EIY >cho @brzۂBV"*ۅ܎4R4ɤTRiGZ"H&K!Q Rh"$"!V\dTJM`nv?xћ|jw#G*~RRdTO+arzĩRIK I*av3o\.w'檅NQ:.t]D躉u'ENQ:.tBc5vi0_/G. 12a!03q"AQB#@?װ!6$˿ U<0yT`QʣF*U<0yT`xIgql.UʫW*U\UrUʫW*Q\]Bql&UrUʫW*U\UrUʫ mzSrU2LeS*TʦU2 _ň#4L///// KS`q7=mznpj4=ivVVVVVVVVVVShى3QaFG+[nۂlÐ d 4I$e}x&cGmMN\ZN-3X:I`"JFsE&7Zv>[n]fU a-Hk}镞&OP)jE: %5sXXȦ[6& ڧh2L0i~=n&?XSh<eg;p+ E%IŲXH3 ,' 3 DH&itq yf;TAkG,F@)3({rZv>[nӃG#U-_2ZYYm~#[(\v!h+XFR7L F5\蛻Vx{DɚduMsdQq%yC@q:jv%y9DݵA%@A,#f/DN3 #<ψ33>#<ψ33>#<ψ33>#<ψ33>#<ψ33>#<ψ33o2d!sU,eW%XfqFygg|Fygg|Fygg|Fygg|Fygg|Fygg|FZkUC)YET]:˃cQzN u W̖!E?\EZqHGvL|7cS o|>1)L|7cS o|>1)L|7cS o|7^Fu3Q5)iIZf_%FFF+a%c::::::::::::::::::::::%R x [e?24fJ4(4|$Ww5-_2ZT5a޲DPZ-EhZ-EhZ-EhFh4e;ug=*)DDe8c8c8c8c8c8c8c8c8c8c8c8c8bkV^QV+Zo""[e2|!iR\/]z}]HeeeeeeeeeeeeeeeeeeeeeeFc,pme)),8wHcQzأ{5>+_  u VPjR'%V/mC%3 {MZj/J!jPVKoIVI Q)}5k~)u5U1G#WN촩j. ýd>SBqywG]ǗtqywG]ǗtqywG]ǗtqywG]ǗtqywG]ǗtqywG]p6.kNR1ۨ=elQ;%eR3%td̕C2WHfJ ]!+3%td̕C2WHfJ ]!+3%td̕C2WHfJmz,)jjQ W'Z6lgEw}C]BպЫP}zQʦFEb (ߖV1 iBU!H VÑ\Yx1Bɤ;#6(AVQUs|M&ԃj<+ p\H`qNbؠeS'1WEaGE2U9Jfz;HBw~jFzLv0Y[of`I| CKuyn6iOHqhYD BN4CTmN 0u8Ft"e3tɖO(Șf0̫vo(dV%{NSUOa\ bT3)@=֚$+vZT5a޲DWbP3׺cQzأ{5#KHR_\Ww5-_2ZT5a޲DWbP3׺cQzأ{5#KHR_\Ww5-_2ZT5a޲DWbP3׺cQzأ{5#KHR_\Ww5-[QXB(VYng*Z[dFXssī39L\{O{Ҥ?٨'^ ߚў3V٬>_2Bࢻj)bB!PϘdm>MmF":ڴ[8.q Gm6#{5ΠNmfG"TLM b4) 6)8+WGDmHkxCjQlb$Uk&(G?$FR]63ӌS/7ݖ!E?w؄=F{B,r" (3Jvc"2Kͦi3 TQ54ѐa9xwԔ8*e>AIRCh^F+b @-œYBJfcBDK-ԩu$4ȏ{p0kJ.M}|1Jq.Zk;\ CKtAmPA:˿S HICB 2*b9f+RfB>R) d} }EcM qK-fFA'wp(0c3)z E< PMiY!]6nLBsQFfb ҵUREQT1c]ATS bIJ!FrU$ē-$ͧ[1% :)gͲs.\Bt 4kL!E?w؄eȄhQmAЛt*Ԓ˔@E=`*hj G%rSې(h49%D|’P5IG0D$b ne)timC:'1LS*^ h5}u B[ lUiHRP [Qϛh9-*t"}qIa @pe3:.ʮi&  aZK-Ґo?ڜ;Ud3 Yh,TsXd&E#hA104T2_qW BbKB$c ksHBIN"Iue (r5d)̧yOq ={;ug7X0}?֩A0y0:Ǵ`!Yr+OBDb)qՔ9$8KY0tjƦÖW*F95eWô٬kf)ZÝeiL=[TYJb($Vs6IXsJԘ&rI=QK,s9;f!xRd_pBࢻj;EöC[G[{`p]JS .6 m՝iHmeODHHb- 4%֪Nj. ýd>'w桴gtn FkG̐"n()e?J )un ?~&!+."ʘDLebN:AG& \UG#i7GgkJcI%dH5 R/i҂]TɡgF(jJj2c,8(4SUvI TMn8oHDc,E"k 2;(e^-—)Y[ƚ ymz;HBwx39r6H7XFHçs*Hn URJX|6a(`^CjUJbn--:\1țK u VVZK\# ҏ ҧX4DR1 Uie%KmDž  u!-Tbq'4)ّQ<5 %8ۄjIr ҬSUdLD*}Q ""C*݅  )pOgnýd>'wӇƺ2_pӿqVJ"W&0ێ# PAU$NVhz=TrHvl5%u/%5Xe<>O=Gޮ$d\6a(`\6RXpt߃^[ybP <8R!HͲ{ahDvIGdBY"}dPV.!Ew}C]Bո(i8rń?*W=QQyR!E?w؄^$+M0lS8o#=DΝcyc8bZ)8Yb[n.E I:sR CmRDdH"D=3R5WUr i]iK8#PIJցXثCh^F+b @.[0ZGPfqĖ"DAî!IvfH+1 "%iE`DU'ag:'\\\:*qL27 . 39ZZ Um{ u Vfr.sb='u.ROiRZM<uYVIKJf Y5e9' :GZWbP3׺cQz! F{qG Ԕ̺A%$) /. + ˫ːuV Z!DDm0O4p9WAԧ㑇i,k,IISOr[K*_ɈRqs.@Ti%3dwi3>@kIo}$фkYc s3Gg&䴩j. E\veJ)>'w桴gtDjO8kd5? rbI}%$) /. +[f*u&f3wI")2uDBFʘ0'sK\OEӐJ3JV"-@*ڪETlqxadL6%V332\# Sn_䴩j.z?R}A`64~0}?d!Ew}C]BչJo#!@ᛦ圂:JҖ8B+쫴j'Ja"L9$|R^Fl0i2bx7Jr ~vԚJI N(Xf%G H"IE`ᩖ8]39q؇Ib4\VrUңG!InM͛Ҥ?٨E8(-$qIIXDgc/qYj-maLMrfY|DqHR_\Ww5-[LHE\HI RRIb"ܖ!Eѝs5 =|6:gwHR_\Ww5-_2ZT5󓨅LZkpZkpZkpZkpZkpZkpZح$GXiFLȲm1-7Zo i2xeMᖛ-7Zo i2xeMᖛ-7Zo i2xeM[ oӐ_PMᖛ-7Zo i2xeMᖛ-7Zo i2xeMᖛ-7Zo i2xe)(\96۵PVR) C?!Hg3R) C?!Hg3R) C?!Hg3R) 8m"uݚ˂_,!1QaAq 0@сP`?! hI}////////////[Bje&7ynw7ynw7ynwN)}Om&$]c\I&'{{yT#­b.#R(U' %):O{{{;*fXRKB\7 fͦ_tmrІI;zkZֵkZֵkZ_H%`j LLk͛L5H7IMnt&7IMnt&7IMntpɵSu-[;8٨8zsnzl.OJvʔbbF HJ'Ԫ[4idISt_4#Hiuem6%>"6ydž_oϣ6m2;1k׿8sԫX1LJV&*X dJљT)elJq4ii$&W+:lEu$9Tʉ\‚sL/ct !R)*spࡩAXMDdTʡ3hRy8(O(ଉv{4fͦ_y>zOOJѭb.R9Jq?cPR"\\sL/cћ6燘5:E.lL0ݫ4B&e07Rj0tIiBHFGrS|ES3#C0ҨCtarD asW1ѷIeSw4vm+H^]}m^=0Э1 /l%pi\xevڹ,-' Gd8PI|3J[{Jޣ6m2;1k׿a&RHHDCI⩛AJf.+ >.-pCV"f٬ )э[z yE9!N׀,mDc,H$tpPPCkE.B4ڏϴJD^iq1E0{%vç-$MYʚ?(&P7-wkت 5.;b5Svm 0U3f/F{[RܰsX<?)44XD |$Dhl"mMt`E?y*l^{6WX'Yc% >`v*ynGP" ABn%"eLZ2BOPҒq\Yzpi"GSEBNՃGեMh+aQ$m2K юZ)1Ug8([eK$Á'%+#)j9Nl VFJb* 3;S$c(͛L}*v; RڱWxgQgqF.3.PZ]ItF$>nPiݹF>ŵ]_ӵ¥|m2K ю[ğtpJEefGYN$9 r\v|*Kk#mRK讫ƒ(R $LDA2%~ixy^}Q2RQsQPAh9PR| >+9 >՗QE,8NBIF> LJ*ׯ=qmfeղ>9f%/q0z$ytr*Z(w\xev3fpݪc (cׯ~.Zmgמ8s꛽d%QQDͫ b| ښѦ+Qɱފ#ه|Mw>: 6jc*I596\#eP, S^RN!dž_oϢ] Ty^I%mg5{[Yp>-߳@YWZtBo,!Er/lБ 5kOrWB6>4_κ^Fٸ=I1D} 3}-z KjZPR/kB~;! p>E./'Nus6&hVC~-ƻ9egu  b}}}})5}}})st>}<}}}<ʳ 0 0 %{<0 0 0|.}%,LAPhfEA0 G ep=ONue+$c$iٌnPbL! k=[wQqb$ I.|_IaJ FAeb9{J]&tDFp=ONue+IJbngBceѻ.,ơ!R, !8tZTV;tERbĮ,Ʀ>~ ABpp=ONue+18*bz1b$~&WU482b!(1ƒPǗs*FSE.-vi!+0,F[KWU֕!'$RW=h8fK?Wx\Z1 K5 LNڿ*-!WF^"~j(mWqj5w]ƮWq4acW$Y,K%dY,s˼n,K%dY,K%;{_*1 !AaQq0@?oP:eniXFifififnk's43L43L43L$t{Gt{Gt{w+Q 'O+ОW}L3gϩS>}L3gϩS>}L3gP0U2?"ggޝ7i;MoNzvӴޝ7i;MoNzvӴޝ7i;MoNzvӴ/Wşz3вqԏTa>~~~~~~~~~~~~~~~~~~~~~~~Po@5(2  *&P-?yyyyyyyyyyyyyyyyyyyyyyyy)38XF S=U⯥п$g)$wyr'7}9*SB^E]sc͏6?sc͏6?sc͏6?sc͏6?sc͏6?sc 8I /VF8s"vʼp}u]u]u]u]u]u,xc4E+Qbئ!Y`ӈz'7}9 `:ڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڧڠÀHoވldw#6Gy;͑ldw#6Gy;͑ldw#6Gy;͑:&y,3@M@Gyj~AD`==_Nnⷬ:<)nnsw77ynnsw77ynnswJBePI3W!G\y/ #yOK'ؓtƆ5wI|%{8GB[Ԫic恧ch*zSPi %XbxrnA[ \%55^+zK$"ŭDaaaaabj̴PIŞk f$>b<Q Qw_bŋ,Xbŋ,Xbŋy .ebyQC A6\C~InBcM~dA[gA(ŸmUQUlݼ # Vk8[D2Wl9S@)C]9 U0ƨP:؁}9޳_;'I}soߔk|ί]'ϡmCB?ZuA8X9hެdxU*'d|X8 _8MiEuy"PBH,;!>+vxrTX^;x}9޳_;'I}soߔk|ί]'к;ƾ oY$E>7o5>gWZƾ oY$E>7o5>gWо@W*uZsr %6DX@ &v~60N`dS3huG EAst/g3v.OD=9(L_ҺOAF),+PN#7 ^%I+9s(,ZfS\Ёm[l  +7Q#vFOM[F#sT81 C1 [Kb ƾ oY h]UfmgtF/Vi#,yAjQA@gX."<9:IӰl*d L@)[9A1d^|( rBC\DiX 㔋WG\7AǴ֟` AZQ"J;1YVJ0(6K^>aWDaiWϙ+ylNmT%c8,alrRp1P҅ rC K++)h2)4# sT%18;7o)vB3Fԣ1ո)[5be9ɲx'"k"l6ϐ qnԋwV2EbbeqpѵUP8b^ļL#mRQ15>gW&V(O0G\\>uh,II 0i :Ph?5^+z~gq 1d 9A3YgZL/bE<%ÄlƼ/iT*fm!SKLի-+(Ρ9@vrsV h`]F&1rVT-V Q)u|b,4>%M,,xZ6^I.OD=9Ʊ[\8°k20q޸Âr`OẀa4'Irn`ehz+!87ȶ&cҋƒK~,dưp@[<5qh'L_ҺOhost/g3Q* _XJB)u:*V02`6/[ .a pࢭ⺰w!ݑGD w/KES+ltki85Lj)(×Q#p{Apl^]y6.OD=9{W!jkMƸ gt9%aehUbv+Dye͠?+vڸ!8sH[J2lC o#(j(n p"+Pwg Ǫ pZa]@l'>gWc3Z%@,0E_*GxL†O.Z J8EcGL47r= _NnⷬW{NG\72o+JSp䧥$gpڌb4+c֕UZ3ao#cbHsׄ%`rM 1k sЖ,Fq .Ox3cKUbOnF#Ձ*pݪa F*@jܧC Mq4V;__fq:dND|m??psW("jA0bQcPQ2ӂ9%'4(d?ع=HS3|MVr pSWXpeIdZ1yAF83, lUXp}f=$R+ڧÀK2dťV)׉TT{",Ul_ZJg*(\bOlK/9]X!;3g)(󊥓<\) mPlQb˪8Cyf`ƲZsAf j.,0gTBXj!f{G^m\L SI໣x~2 rs^DpCZ[q 0A1jp=—i]Ftba+҈f__5KԩtG5l&dyq&= Dɡ Ib˼k 0v .Y~~+='ba]WjG%(߂ Vq)am7uX[>fFg|/UL JT&i0t݃Gy Ef #Ɛ0TVYrahS`W@ /R{ԹyP`#8E7x֛:kKg\7o5>gWЮ= 5/!jՉ-tfZQ)e4]+FcjmR`5yJl!EL-4 2&:-zIͳ© =T}Bds4qj 9CTo.0`1K"@ *x!c émc3='bqd}d'OY>}d'OY>}d=^> stream xg@G< ĎXcbDcQg7ƒ؍bhb,bA{o (}{yunfvٙEyJxQߗNv>NzB_O@Ҥdxz?26ɲi7TP5Xn2;c>n7+QB(-r.iHgٹr 73J1mz [$3!-M.7'*av+ݟ*nʺH~x|Ѱoe!8+}FPjP"Aĝs]^ƋˊPX+E匏"Xև)M|; ,ܩD*ȼI,a"`i`F g[i C}/**d9ӯց;eUazIš#cϽg) lX65wrdz q,D:~bAJDFJΘ~~nEA0@ Bܭ]~C4Tȑ{HF o4M|p0۟í&yk;p'<=|_c3x?&a3wߥ jwY&$Vs$ϣ;NrI7|Y9++)aߣ/^?c/;Vy"R5rZ% oRIǐs|Rs~~>;$>nFd!C9a|**}o.kW՝} BYEn>a׷1J1p;+~l̈́pdkNu*3L"zOBprso7Xb]]Tr{EIenf<7ʵmU*hs0yTaC71Tv헝~';Y*uE{L|{ر.W m'gGV+G4 vvq7%[d$,Jem,EwϮv}44 7RZ:$Ȱup 6%vK"Ezm|- PNA <5tΞfmؤح9e.uҟ_1JPE ?Dkh4_@eqQ 7PQ܆cb985ڸGVkOhR`"IT {Óooޡp9~'CDLmfGwwt#YDǵ8*d 3m r XrƳ}\r[STy69aݜw|sEJX_sA,ʏ`aw؛uKc8yjEA߲4PƦ`1)\ X䝞7(cn>yOEe{r@(x% @)PUUnÖ/W|^ӌZױutٽt|ɤ*5zCGəq[ɂvK[?!#c 3sݼ<\`ݩh~N$vs40̬ާ4`_}˺g3nѣzgw+ { zWI\U[Oz2^yN9СEB%Lc9eDɆkի^q1eGybQ/cѝh8=-%᪉'˚;kwFe8#e"gWWAWuK_׺i1lv6O{=)6Cd43r~Q:ۯ `N AHNwSK{]Ǟ `g6%xBd2%ma{SJ`o!)+>*-w?SA;b0+/D4Sg87KpʆŸoǍCYБwr:"{0=?]nh4vSk;Zr7IZt&>#k]\wmO&0ISf},_\D;e%~G nst LJjK^jjF /yΦ:MeAηMaq=Yt[d>PzBioti93h&3D=g(;'PwQ qbrH26|>}uw7PvV66 K|/ǘ9OH>ES9U}G=e1RYuFu7۫H gWz߫(ROjTWAid\'HYpWmzh5A;4=9϶Gd<6~3P^*Vw Fdѐ|'Y צ7H;O˷QO`@Oja~i$ *,Z6BZMU- E;b~>xS{r:j5X=(X9JKX*5w[a秐?sh6D!e: ҼYw +gAߒu-RC.[^jp{rFFj^Mȍ_[rkBO5}ضGjЧW'epkevC噸D ZMk#9.VzPp_@Ê]D$u#|ǦIi϶lr뛼Uqۆ PAsx/dmttiWc]R#\sӲĖp v% N`X#lG}rn-212KDj4AmǺk!5!Zg{ W0zÆڕBw "F&?XG5S{o*c!+s@I2IƩQx$vM\,U g5rӡ0da5 h*bZ rA-bC)7#$l}HtgOrDzhPGlr5r,\XX&+qhWx=HNƥAh_KA-Х]#g?h{EJΌ_yZ#T;)T]^rmjط;6+wS5?@$!d˨ϵjp0SRǖq\eD'N5TNhi8SQ99?a욟Q+yd1+Lə Y6wy@U 6 vqFS/+ٕVSInڳM0Sy4fN,iWn%)|Sz~}kA`ˉ>h0s+lnj[.>@$YOmn;-hϻN4ܗqcʙwnj噎3r>9SW@Cمīr53(mt9 i.律ZAlQrN`o7ᅡQ0qbSIx§j4#hwcdYIM祇H{8k/#kAҙ?u0洅dXnh23*oA0^itbi93N] s\~yv9rF x~p*̰Lh֍fi|gr/1VNMw &| 9?}<\9;1%gFP8LŗjCvP9%_k5_j 7k[?KxŎRy418ٚO&p*n/"3y/I/^g~ ET\I+rv%^Yژw9u6<u1+'4v#M)$͵W oz! 4QO8U2~ERn%u.Y~AYB΂ Љa ;zr'=Kf5wBNh";l㷯aoQL@[VTd&!nǢ!h47:9`:"wZ9ߎѤI9$7Jܻԡrt{ڔ 9S0MᤓfG_f,j. =GHڭݓ df&YZy?RMZθv6|ТgqQW ֋yE_L ;uZ<ܓr^nC:>Uo럝;!yIjsoɑ?~`cʙO'1,hrIșцޟ4PHmTqMr(evu;/vM183'KVy6쓾}^wd&|'^ Z6|09TrC/ dSR?+ZvŤ7/+9˹}v&J03oGL\/(ZiW&U6xVlvN!03r` 6P9iadyb~w:}4_ݮçi3 ƥw2)[ʹԢ;.Lə`$[2>_ۈ+hr&56-:B%_/0!9yZI;g.c夶wN~,9ͤ:PVCs-,7UW$-` gsL89D eșMM$24ϡ{減N+#9%Gy5 6vIq۟vJx{2)g)`{~sE<T໙șXAE)c$VN^ }DT Z|w]}ȎJș#7ZGQ\ +^mVob{9z0 zTCZCtOM 㰁߾HTΈ_==?* *?uraʩ]t:m R)^Jjr^VxgEr>d|BNNOn&<~ڔm!gQk.CIu .YUln. ؘ/g23i LY:U'kǡ&MNpxqC?I+#;`BSa;ɿ!4o/l]~*rl4aZx7~3aK%r˛IZtq#~3n.3N~)9g8Lm+s9cܰk͏7[Ou#[$'[jW}w<& )ål@&w#]Ҕ\9.3[R:My=#F\b33 L wݣ'\-s4$U0W7$E& f_6訔_H }Z›$8{9+ P,yG9G==rZCR\vjanmm5}w#Q9zqs=KnP詙9I.]Õ+~)wT~)wډRGb~IH#< @Δ2D;!fiE>!HnN}bRNBJ.9i@xb>f#oU!UusySnтjo`=əJՈ^OR-=O.LIncڛ(:=6.$N#b >[Ҋ%Á19W=^U龾{ө7- iaYI@NM7NMtlO.Ԗ=s&Js%|:%[NfA.D$- mE["&0Ѯ.!w[UVL=~Zlܗ&9`*+cӼYld+ȩԷWHJ^紽/K\I߂vM3)&d;{}]:p]@ 䌝Ė36$GIC2/3\R/U6?{ vHWL}}΋] pAunbՂ L(6J%zdm^F{ F8]FRt9NΑr^][inT^7ӥ/_zW ^.:>ҽ\T 'J "``NPs- c+Snrҷ'jWnr@E}@}`')Cu9C`Ke 3LcVtX)vJ YL?UXNZO `n(^`B`^?=KbU؏2Q$W3+g?I_DNxJ$%:s]dz1rE7 _a#-q%[5$i[i\`Dș|'ad>T'P~JVvcJG+osR! /'4 _HP-+F mm0<(A=./4$R}\d'| wTy[Ҩ65f 7~=yp84:N{ D1=Zo_xPkNNV焭lc\p_W|vrgޟ EI?]mқA/}m.zM<{6J{!_|'Yܯ-DTVQry?M|_c{ѯ!|ǵû&N!"dn_BhCgp0:w Tn2]MJ;tzKAB ;@pANԠDŽ1g̉}G*a'zk?4W3ѱutхZ=v>3WAΗՕhq#:/Ȅ^eߍب{W}O Nug=KRKС Qȭ4gJ{SNM|Fz{/r lV/XgeA<{48wFǦN:#w}'d9X '֧́b~2#x6xoi^CN-0-)ݗd MZb=Є_aAww%9z {Vs,9`s7bh`f"igLp)L-HHo]IgFO&W tH Gw^;xW+~Ws.6mAڬW]Bs2g}٢ 6ɠX~oȈ?0B?) qgMڎжwo'"-Cā0 ^aŋ͙̕a ߴ:IQl_}Gr`3,S[Ho3{eTmoIeȹzCɜ!U/Q^såOB|5eSri\wq$!C]DZ<Ï H63o-wg鯷G/ۃ,[|GtywB' AIv,d =|}~a2wb AnAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA6=rŦkTQ7j0n'[%屟b\E8lmUQ.6)c\EtIʉ| r" ʉ ((l2~-9%| P6PN<]E]qْU2x0^6D)G(lvǡl*l*o+N/.(G(lz[;Y@ْU2IT#S6[;Yـl*Lvҳ#S6㝳(4(\PN%A9erTS(\PN%A9erTS#-(|rS.(2Èf5PN%A9(!O,gʩ$(4ENլB9&9+Yr* )M7Yr* ) )SIPNiPN٠JrJr棔PNiPN|r|D!SS6nSHS% ) )QNT WPNiPN9&ϕ(YҠ-r2(XRҠ5rV{DɒM:i(rA9-S.(rRPNrZfʩ$(4G4֜j(9 7׫_U(9ŨrB9&waFVJrJ\gFVJrJӌB9 ʩ$(4(lPN%A9A9ekZ2& ) )\#ggʖ1QPNiPN9ݾkе) )\#&*[PNiPNj9YҠr6B9%A9KSSSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )SSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )SSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )SSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )SSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )SSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )SSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )SSQPNҠrTS.(4(rA9A9 ) ʩ((\PNiPNEA9rJr* )sLoJfQNB\DlfQN٠|xQLD9 V0nS6(9$mh\o ('B<2 i+26mxnb?Iԉax/lb7)7Ԅ*~pVۺKM S6(9hdlXG?'kGªr7T])#f[8 rʡf7ģij4Ss494h&k |;Ys>唋ٓvNBpl2v؍4&!0U 8 A6[N%1k =91ʩ=ʝqD9ewǦkrfy;X_BS6(9Ykv ~S#"tաA9@NU #9 ;T izrn> stream x]K$IrǯBtuW tѠâv5E_xdVXðe^Y>,5[_./ߗRoOo5kx_nuOShϋ gV6KnzzJyg2l;A`vOS=thOy aexD3mGپ/0֊Ʈǜr L&}mfC 1΅|4uNIж8/KX:msy + RMPT\t+ezJIlam3 ұ-r{kIG~'Ȱ ` lLl= q-i( !4AoT{bC]n 2jh+ MPK' 'g*LفUШ*urdz>{:qa v n@lUQ }BG]7M CT3 kM MgX[0}:}X~ HM+]qŧ4,%G'iS4@ց زO\a:Lp0d&uYW|W`Ɏ]ּii\ss]&]{P] LU} V+ZpUVC|O\eEj.4\qu}g(0Ue_?r%Ws:F`--zz-*rVgjx~&%ZES#͍5iKBz'.ˆ4bc`B@Z}+ hH+5`A`(CoZ7=08͍B #NAu`'=(Gi5&eǸBͦص`1 1jH^+.61,@9,>e&1d-.Yyɀ\n˚$rb2]fs6 -g&ctO!=ȗ,`[d h`{gݳ)?T CF,,(4I凩4d}:3@uJ I< 'LU2C܋tAPK}9@D}sIBS_֥ I([֌0k̅ar)2Rzv3S"4bC +*zߡ; EUlw[hT?"f#5X$,hunxvIT%e*h+~NMCX1-\I @.&e'9ʙpܸށ,( 2ڃXfX3ZX|d*%1x6ΓEd%> $WPذprL []Ӱ +*jQpXfD1,$3E 4H$ F4O]׳G+ʎ+GMfBDf\y@_ Jw W;2/ChIT1乺 b_UōM~`Z?Hf^W+yyPTCMaXAg4y(/CQ:3;vw%肷w1١,:a`ԢF37u)|2 9%GZA9W U{ԺH;;tU_ì4F=Ѵt$DQa5(O<c(?=?;-`Kz:05&wͱ?~]֐7}~>iaeޞ?m y}@kJy[X/JS~ë~[+?ǯ=vq&,>¨#wh^ry>|%I:ӽ awuvF+ !Lҋ_mV^2VT-#X_.eWB|F(s8I(#mYsEw) nS5sHb4tg? 9 ք >Qۤx"'n77'$aS{, TX̙ϸ1))ݷ"!f\H!s\N o \@|AILg%&ix:IỦ?ojd^FaKm٩ 0ek4nCU70N߶ė#twةK-D-CN $VH&J"A#XmUv5NkͽVNYzޙ!r&oAP[+fJt3|L([P!|  /U3> &ش0 2'լ C+[{zOxT|'9`ml[of#Y'iL2%Hr{uZC.C]; m˺SN6q8Qw/u6CM O=5ZsbuY@y 2DVR_ؒ;ߔPVQPGL_pxʎo&]; bMgE ;;#MazX}Ԃ`]dŘ;Bc^f}g}')V/`UK8˓s^M3`GZۏT18 }Us xd.ѣζ/sW? ף_0T]V|8Bm ٢(4r$Ÿʌl^a>G4V+WiG'~( # \~޲SH|Ua5uY~P!T/yUVs(*7l*Z6s9雜W١bҥ"\)/E2oģjꀆ_8$dhw@O2wW*hܝӪƄ};7(Mkœpꑜ'}L;Q\jԁ`i%&V}tUxs`,,A"-]:(Wwj0kԯ?h*=OEӐ 1϶YӤ'@Q6ϣ u^@e/̟ t_A endstream endobj 101 0 obj 6254 endobj 103 0 obj <> stream x[KoVoȶ :@z4\r &b^916/_~{/-ԇi<$pа?ck!ﭔ9 P'd@^ HHN2F>IԒ6خѕM $ӧ75- pYd XG@2X& F̓j0<29OT!z7Dˁ&:`#ĀtyᲱ0e14}xMW @u4ҢCtC nv}1=X6I_ֆY6M8<Ճ,`kݦƂbuت~6~ߊ[KnlU5Bi9FkPչNXmSZzhYI0-jX^+ȵ5i#dh@|^4n_K!GfC!k\b-4jQ%,qfR#H=i&}*z`f?P΋1M{Im0par/6Ӝ58_L^9~ۿm¾ !:};Q0w^ܼ2'c̰3loޠ_86ؙlb.])ɑ]D*O.\՘n!?v5|p>Sq F\"qϡ\*r)L,A/sx ,]4ѫ0pxE}\nP}AUx7sp#x%$!e^l>y#:%JѦ߬YeHǬd)";tyUFy5OYiS|ʐ5wȪ]}rSykUSTYFr5ꅫkz\UHvrUUqS%h.7sUq W#r֛*QԨNիFŋG*dvvi sݩw:U0$+Tr yPC t+B*I 4H+4Q@ (4Bѧ-:`dyP/<֙{DXgP'hi0v lYCGUJV)b,Ћ7 p]t}}DnEb"p!ncsr`4z\>t)r([iu<*s\.x#f}Uo?~|">eȚ;_e6AXЫl_WSપvpDhz.{*eu&H]/bz'` :ٸU`FT)U"a▃mǛBU4`3m;a;`IQ6$JH[f{8A ]"s:P=h~L7Ќ0m D.f y}D.>6*6 t7N-*#e4SծՓS(}`J/K\b; ιU'*,F [&#@eA|Zwɘ&NvNj%BfpZ$u\:W ]0S DpM̕2D8ݎ[_n\O&o.VpP=&hDڔCړOI-4_7)4p@F 15Iƈ3'nAYŔܤXTォRzսu qQ|`}:؆C^%a"7`٭ӏj%E,=` t01\BAkH̸l0"3F_7"9Ky>xMGTY"Y ԕOPȈ b% Yنٲa݃ߐ}m+Y7V+A $]M RxP*Y'V5K EգrU'P] IO~ouVaސﰞS^ t:s7@Fe@  c@|?ύUl.ڄPL@ pU=5&5DC é?MFjx-4ƫ䏿 1Bc u,BV}"'S/} T:l#%QGmBy (fV9|0D.ߥ,TQ3謦$+r}M!wKY'z[("tI쒞Pj̰'kBV2L-Y!bˑO*2!d7(;b`-J))I|sԑꩳ)Äryp\$,IZrJF)!dCjOU1ZՕ'u>5W)i؍MAn|:Y9)sF:]&9#qKy2_3"HK~&~3v)>I{<a#|}]I7[LEH.9+H =!+PC-+n !7Cup]RqI.qxSQ(]9A l'+{QA`Fp.$c){0 ֺ]2~ K!)ڰj>CXCM| H4rEc`uؓ6c+Izjaq*xi۟69N$e;M%v@;*hէ-KpǩES)GO󀫚H)r,YVЅ9k(2*6ʃ9O[aneܮJ|= 8i&yTB"!8d'8եD! ^wTK GJpz4[ՀD Ͳ3ѕZ btF-#N'k64vO+O0iYկx/sjWhŲ|~v)9ㅞS~Sy $똊lp/Q 3\c|tCñ8OAj'׻:Ok8WQږE7Oz³D1Hԙ%IƥON/[JޱiS>w?_?Su&Sb3{WfSǘ̞Zo;;XYdy%G6t9o? yrHٹ'vq`dο/]Tw ;+SioI.p|:z^aL)WykLy~w1SYze1N?c%`__7}^y/s3r endstream endobj 104 0 obj 4815 endobj 106 0 obj <> stream x]M9rWy$ 4Э 6 ^ fevj X,WI`|1g{qm/;򟮄|ퟩ~!o,Q/F~=׳mWB]J-r5*٢ٶz1t9or6_|nWR-قmz˹jlcp_]S֐q__O7WσP þ)yx@)6:<$ݵ@zvkqgb2@ 07C @#: OԩoidI4G֮7cؗL6t*miȉ@'@xNf֨[!{S0gm4(*G26f4ho*}Tī p!x\,logb犉bT4z3/2`:="'d؛  D`lXϤ$)2<<CM(' [\ DB X/@g}2'TIwHиN jxxhຢ9$ShFrNTAIB&AFc4jq{**0Rr;@!AkTq:mȴ+ ,sTxAKM`ɊVGrU,#hYic`VxX^VU5VN>6::HG&X6VW3@uV;IWِ ݆U:1$< U21ɨͬboI_ g'@k055c5ZM<%PAnFc h9hp a* )VSW95իWr}@P{)un Y0O 0@Үtx5xقF^F@Rsun j\'&pqKH;KdCd*[K vъfLq :p)P>z 5_%$aMfZY".kJ3SwL$m :cj$mK63ޒ W%4E,խ|w/Y;Kmskƾdch,-5jT,w^R32SC[kn-VgjxTZ kTSG#kKhYr=EX+c%}Pڰh΀!'R3:^ׁ%DIz8ffʎBIصdЌCGKI:xzM Dnۗ~YK֜m<',ٌ;9&ZrC֤Ԓi925g[>$3L&+ukdw~9+^eK}̽ا$җCoej#,g+kEbU,U o,Dj *'Zо[@vfq8ׄHġTM]8s$(yF(i`%uquM3G! J3< (_&YUC=$ {bգY< ] #1тlA C*AVIf<3 O̮&^w[ahdd~jԹ*YHHÉ٩iF\$MMRJv3+D87):k%pMě˩nMTLI"O790 dJΤ_'_e2T ϠU6 OaY:e>SO'i1 Xeof Muw+Cр R3|[OvU@OuRSy:IHS0p\6[0_C\/a 9F _-~\2k֢ Y;8[]5*Y 5tj:>An]펀A<}2JqL/FF絛&!Mٗh~=qYhMYt(&Jf.lm12xs)Ax}sNP>ACيBSƋTd^"B .U^em?G0= $tCEV&JYUFx(W=G綠сtDVA~Kgigh},c%tF[ݘ?? fI * –e3Y7ujUE"KIJ7@M 4R9^NTgqzJ}Ô\]ȴ9JwnE,6_lLhZ> Rè OuCA?>m/P!~|a4gwtA \cKl՝:WOxG .3}%m|23l}|A#qᙉT~9ycyL']nE?L &`N27iwH6_x>/70Ntm$zv\L4bKK@}M4 vbym}l!U(aezYOH }2LwSM,F"Fq]WQ3A a0L$dQ4ɳiԑDWG2BaTe(Sוl1Yj6ie٨UmaPO,)?`1DU3}T4=HSz9޺^WLלg2"_a~>Kcw\Xy\٤\A%>,9D`u; ,t5O[O%ozӣ1F0Â1"l-؝}xSdtu{&WL艕6ncm鬊.2ZϫqVv&7F?9~6#) MqUc6.dY(G+zǾv32^ kS\9{‚TirD>u<@Y|F=΂/$=lL''D$ewx<OicX{7tlY7(uVVĚ, !ORtk=_EAaaOJg?n> zJi{cۆ^-l6V֟ џ/:NE9٢z@kA Q rAo iGj~Y0U`e|\ȕfo?L.oS.t3j_-oɯ=5 endstream endobj 107 0 obj 6025 endobj 109 0 obj <> stream x\[Hr~ׯ8]V3i6mL߼L/߷2I::Ua,}222"2nSmm!ڈO,nS_KOnq qO?guč>gmlT.Tƕr=_NzЯ[|eJ:.+]ϗ|)^~9_|>n]qxœOe\ϗrʗ1^/r4|RKzTz>z4_or1J_/S2ciszk}#>A@_5L'7 "zụ2QB7s}|m7i mL}n`^&70yrH<2]-g'39Z!ґI/Ҡ5n`K$m6F_0thcZWl~ S&i%m@1 Y] 9ZĔу@c&%\fZ@yPHH\'BIԒ6hj9T3d2"N7b<YGz0N{0zPTB.3]|@C߅v5X|pHv.%#.MY|sHm}*$>->:\.ۥiYd$]bY]R]'ʇ\nT}I)wcs_(<'Ճ$⋞rhW(Ece5Njhb sJOkCuSE5wU֧մjwW*dUOFUZ_TЍzk~냜:$;9uU\e׉q=CuN r=";:utDQW#v2;uմv¹ܾs}x&bbLUkX.PQH5~`]6AbdXa]x@ۥQF*>o0$ۈÇFYagh50HuV% Fyn 5AAcfI Mf}kzlkUdKz72ZWk{R|}ZKr0?Ǜ&ΝJDԺ[VF KMF !˂ZޤbCWV)\X7L eu.R$ԛҹF5l ,F̛2_Wr;zPl}_~21d~5u"`vՃn.LKtrwȥɻW/BYnȂ$ sz 5hPAV+E3%7{6&ݸ`Խ]uoq]B(H ~Yc:؇U^%"'w@|3XV twGuBK#:8TZUGd=$ f6m4]qy;_k`AfuуXPQ(3_v]{^꬧Ydd b%tXWeIll~XYi)OHL~Jx@V_5Jv:)A ZubSP$< :]m]ܥyVj/8%)}s8%@3Gy dYFA^($#dxszXP.-`I#5!f;=HwJ_D{Hc'fk!?0x Ą>'2!i̟L!#(WF5HD und:V\y~%:tԅ4uqvGC-$sjgIa^DpH}S 9#y!q^AK^bqvNfSܭ7Bg {<<ɦ=~Һ]*~ +!)RXSBuK㘡y{SEPRu8BxX/>A ѧ-P;..MYOzkYPj`GYt^C`Of:BwJx$ڕ%48ؓ"͊e]. XبjVub VnRUQ zI8PuH"w Nu%|J$kW>b"ѕnI)sH N8Fyk̚>~&5:R+ANled | ۄdɬW|Lu lzj0@ TVQ]Q ~L},9@lxs f?{|eϾ5O/QWnRҒTO( 7+EWgaV͡/H4>_OɎӆ(ӆJ\NO|։@T~U!TLTgX?䛾9Mg&߈g&djދAzMܬߴYdQ77pRȕ> '֝~Wx}.*Om'\^e>0F}>9Q"شf\{ܶܽ7Yâ[xNRyS~w'"gW ~1[>s7DS|vͯ7ko>RK{2 7$C/ȩ|"ǿ'0g6%yG }~z1jKP'}~?]bnabdtY0F_?GD욦[[KST'2~S]=ri#g Sט ~f $=j*o!B!_ݶb2g8u:/c}F'k ff ߔ45"<=fچ鵵EhJ@u"u401btwGV&].Ha/S}xE(Y 3A2ҍ#>}zݼ$ oA`+G7)GdyL3S~ۥt$xS)TQ)#`/Aoo2)uoQ5FNQc{u~ѧѫݵqi= U7K;½c{A&ɷ7n%;~2z bs+ݠea=;QaqgWg<i/GdovJ/I_%" N.Ί-z1.XZ stE%{s}P<_I:*:ZH}AfF!@ /38?ؐ׻5mr/w⻊9*p[m[u~HpT ʹk)۠s_9-wDvSD!~Vf\?V"E)1;;yjХͷm joׯ}{O>z ^[ZBޝ48qq̕t/[J.=_2? 4e{|o={"_%wL2:B |xOyi~5#A %ĥfk?F?ruyUoZ+`pvekt%_Mx7ąyY5aJGAds$ۘ˛~L yZ_U s[r̾.VΚ'zv:M#]4j=RT'Z/ * GEɉrlxR) [tH%TVWӝ_9q-h9\vSΩl4?Ot.:anN,O.;2aT18_:x>>?u endstream endobj 110 0 obj 5600 endobj 112 0 obj <> stream x]K%9r8끺N%h vugܘ.ߩ<0ah/SPD(^ҩ_>⣍ۿv[/b~Oh_~k}hG/ʋ7φc[>zzIk2l;A`v/K$@=uh/e D31# Q=SN0 $2w g܎a:5Ds\/9;uJ>g x+sU@G4VABPh~ʷ{:=vi/ )R{ك(`h԰;z7 )f^txE#>#c4XH00+,?yPʰjcϚڇ3Աeٴaj#'/ܣXߚޝvub`:ܬdY%&2VI As {x,DIuIɤ_(м*D䷝0̡;k~7EaYHd$zh$ 2УƤAr@}J1'KmԤL`FUlIc'1idR)jЧ:i)TD5=jdID^v&Tӱ7[[42KC$+G%Kj< An1Acd8d9S 9Ms)uG"ڦp43Fs*8ζ%{?4sѶlϲ_lcwdx82Ego[L3z'sfr[jTsdpo'sefu@kRm <9mC}r삷5/NџBlkذP.qqMwz,=ʗx!w!/ك=X{6㇀A`h``bAH&?;xe33C䤚yDah6{rŰ'ћF]+ުn/{oJ/ggNNMk-`!n"7\%H8GN#6 DAzH8N <$y%Ϲ9s6`I[U݀nZ7,Sr&}3!AUvnƠ38l/X;vSId)0wփe;#}vˋQx Sj4L]C>]M%;I/LUo\KTZ8ƱR^y=PlV !n@+ IkVmI⋤˭, >Io MCrC#nUX BL'i-Q/֑ Ɗ2WQI(AV9ä\69\6q1Ruְъ,".Obņ!"ENY;:IΒG:# %1J X"G{D$gA2֘ @p!Wc6x Sl) SE[ІAbd4Q/؞Qj,Â09s=\ֈB쐢I!GP5GQ<{')g\ 3 QA9`1gPڐ4pT53^ӄ.U !.I8O托pIJS߅֭ M([׵׌L5B@EnT9%95o73Ů¡Z@9/B8 TM|~AwtE.硝Un ݃z o# j=RYA͒Vp]g6%SĖM W6l!5u"-RI@..egĜr&w b :`=+mbp?s5iQI^Ru"(1a\`r$E_/N Pgk8ߌ"B6S@3܌A h0 ,/- K;AM˷eLA2/ۼOu@%qy續.Pe,em?Gp-$ 7LE7[dAdqpN Hx 5!kQ`I [ZUw7UFy^*΋y:_:f ܽr:WsYBٔW_܉'&zuj1-3gǪۙeg<`בd"ޓ1^wuz2_y'zi(*|]Wk7G7h-c {69'Gz }Jߋs>1u4D1Wox)Ь~;@3,îz{*Rq&h SZX.oKx;V kfy ?.qR!A@⭽>˙hm%K!ë]҈Õ0Ub$Lvo\zųь2fQ:$%8Dⓦ)ΚE7iU7( G봰N׳b}:GhkժK3ޓ|/79MA7vE~t>u 'AgpЀ:NtkfK`>һmuQ[D?rb=Uu;ZhZk|a)kUѤ: 'FGg+{ʔDI[բN1_8snPIQ}_s۱d I‚|>4;VRt̂ӗh_ |sP?9 C?_>qr6 a< $/\hZmʭri˅wtLXׯj<\ OR}aHW$Wf1lSz;"I}/ TϪtU&)X]yB]&D|U{kUf|_MЧU5497tkڱ-)-2sq^;ZVe2Ѝ동4~#GCSYo}+e^3Hy8w5ã{zMמ|GL9H3'0RtA;:WICgG?4"O)Ȭ@:v\FІy/'} ŧl^"Mat\!tI*vz tM (cs37揤4<K*yRQ }w5BS*^fTkJb\ة?Iq<9 1*ݵ7cTU^onoTs6f7$ꋼDT{h«>ḳ~9<=Sb|2DQ _\̇u\1?UgsOgf|ێ(Z7ƽ?#\%߅}|=H%'{t6Y^\zK{8sᆭ=_/G)ilPj1yL<ؤ`rmtc*̣Gd[Qt jvsٓ0OU.dWC#Ƿ2>5ʖ){7/e:_{ɧLS> stream x]K9nׯ8|SzKqmnLA;&?%CUuuOY$ADJ({ ؏j6ˣԗhG_# v"ǿ_mk%?Z)_zN'/@ n==N@2qBh%]ƃ:0m}}2~cCɃ(Џ"7i2`6$ֆRH[FA zY/j3hdOXh hQ0!%vfg=kRɐWfb&Ģq%P  B35I\"w0\dՊ$n+qg'mr7P^o%_hsdC!kñĜh(KQYBdR#/, S 4aA\ 7# "[3xO Dr|p磿_lk1j's΋I]3<;y~1!as>zCi9L͎]W5?t/G;ؼprbq9gĹ)w`N#_]!$9ir⦝8gcY^Łu:wxɅ>9׋roމw\7≛zqqihI8Jц9Lj&HOcStKDĚK)ru1%]%BUx/1k\$,%Ѝrk|˃\2$;dU\eĸ){:]JodnrTK?xbɐْUl) skn>d 2MUmlYc7>CExdWLAҥ] HB"LxK# T6ΰ `Ѿd zʢ>{ī9_#fW'iHrX.ulPCه-Uwh%ydJ֋_: xλ^n~oO\ q.8^kF0ۜ]"%r\hiv.s)F)7i7ѫwOq!k|-×AXKyK`\ IrK&BsjA M8tA`d#QTIUy0ۛ\U~lfmqA0 L[A"-Au^P=(d%2c t2l 2 $cc쳍k`BТbF͔@*᪞SX~~9q7OtĦHUX;?6g4dkԄbPd[jG>$bFѕVdM΀)dzK @X Cb\\9> hwDcLHee? Fr0[,qA_@e!i+S^p#iH8":Fн*N#ɜy|}%>T BFqΠ Jd}M!5)(*B..Aǩ6D=#KR wvDŊG\dbwc'B -*(T1x-J)$gs51)=u"LCrȳr&;sCT2JݑJ+!RU{n]ɺs8m\qe7eֺ͎]"~䳤hV To gUEP3nFG:8I;cq /b PӧmdwmVz*kY8ZtV$E`>PetyWE])[RdY q62*`PmĈfؤYyHlWſR}r^C:gs@S]H$/vId GX]vt%[R5=R8ij/F%$[f?5>cGTm6aЙe?eL 4b}9.XE!OS|w UePUL@4s{ls8c%4kF|Al=qe?|K ҈8Y T)IIDd%~QdzOxy /i5K5˪o@A6 rȺY/H,EUfzf7 f/( v IVU Lt͆4x謋GҀxaV/s*hMA_Q8NȊwI *7t &~K;ϸʷ.~} 1Ə{}>v MZq|[&M +;WC~k8"vssƝL(tez,WJyiKK ̴W!澄X7_Y!siN bbCLy7Y8CzNo=P=opfjeB\hASC39'#i>ES]zb^!WVg@sy,:ueE^Ό<14 C)kl"5JqWwH8~T(+O}GpnjorDP5zzg'~g[8eǗxj5 4*Mg}'4}SW-8][(1;{R|ǾlX|]u/QtGS]u0.NIr*Zs~sXe]j'i_IcUW xwԊW w-ߪA٦ Y}y[TʁUE'TïS?1̛e1N-!/ul&#eB bux6*Drewzwi"]w]R_͕T8ql)h}N/+S[4WN{.4tOMya#nw9]N9H\Ue&;g{Tg6b}-%q9bO)Rg+WFhyfT4W+~Keٽj ;im)%)OL'.v,3[ފ3혾nK&7uኅ+jX煭XWm]XֻJ%ʸ ܯֻŸ{*L7 j.ámM/d|ѺwbK:.;Ld+2ӳKƜO1vJNi"Eھ]K7Wb1yiĨ_Mmuxj1'^ͭ4}ei:M_Y9S3Tʩmjن"JaNR8O!|}okEUݭU6V}[s7t-rMϖrVڏHf7T/ ^MnIESh%^~5Ӥec~'W֟j)pvZ.uyاUJleg1Ŵ(.ĕ4Q{7+ׇȝK叏RvC endstream endobj 116 0 obj 6530 endobj 118 0 obj <> stream x]M%mׯkRVttY `oS9Aư^)(o۟n?l>o-xo-?tik-7cGV֣4[OoI@ P} v~z,- #\'Q@#,dr^׎NTWrC@ !s>hr;ٜܺt"q ֹ(O sw!Jɉ>F BtLIUPH>;EDX)+%Cg$sqN|kIt(,  v (J8ǰ''K$* ztdZOl @aq4d$ !uCshʐ]{1.R+bE.4=]]@Z&s n ك`԰;(*()ʉUN(`W]]DOu@}8EC & ΃9 M, =v~9I[&z5o42kbU1ݻˮPlqZ(@N Ã`pQ8  @D y<4 tn-71ʜL7t3 `<)[r`2N~DrD'Ni"G!k s72ds6 gӺt)`m_==AƓ(`Q'VpYhjX,Zkr.+^X5y[FpK!vZ"/8^K6: q\֢WޢEҴSї* C59Δ[nU'0*Ix C49P9e%&(JpEIY&40XwZ~Z*in0f '""+` M7ؓArU>Rldjq,S;@*-kҨ0|mTpnM[XTZ08!3<-QMm5R|$]/;-u͖VaP U]Cc>R=2S fXmG"چ0CF̩ɉÜ .VCDZE27l[fp;3E4Lѹ:ݚ#h:WGŃذezGZwǙtz^شGrh_s;/! 5lXK,ssؗL~{I:RaخW/ZZjZ%Y'Kej.K5fi~ucW%ڮԜTZ׶XZaRjhKum[nKEnչ-Um)~\8uc#dž}֒ Vs1 Nl/Zq@iS/;i'M$]@O ]`Vz2(Yf`6%856? fys6fQ,cZסtaɎ i+J e;8`O'pU z_Um5E}q+QU0 sxN ܈(zGdĻ?mVOz<򡵣>.8jG4^I٭P8ՋX]I=[@Io͞GzȤO*4CV´IɃh'5( Ɗ2+ը$kfteò@?¢Uj*:U"],? TW@@.ZKNfQ:|v+CɁٌZ3Yq6cEPᫀ9fdn*6lV4#LZ{d~eR( SJ$iJ^HBE" ;0ybͧ*wX֒VxM@#kCo3yMh ɲNPɻއvRW)*[a*⏨7HklwKʭ`]gضKJԗ W:~ӚNf&#gk,K 32qzDٰ@t_h'dwulK(1e\2BbRǢ//H []idkEMX7`n 4Ad7A@-rA{ g8)$@wfh Tm`МxVv=Pk?*4."OAQɄ l7rq~Ѷ&sJ{>mز|)[l\;k=qxMmҖ ն9oxC ng7-oЯ*HIMnq-oW ; ijPA GŃ:"s";O%:std@y~gPM%?,k1P)b=5 nvkU:itY:Zs; *x{2Ji2hƋby;\cch7IWlM D%1>f^;^,%~wh<[ѱTHY˃aphJ"UYenf#EgJTFHʪԬ8:M_2W6E}: 7Cu%+2NYœ,"T%bnթ .aF3u[n@ 2qadYZ䟳v05>lպv^ ˱/2S~f'ҒʑordLJQP^X?Շ2Fww?ӾV)r[aC{'r񐺌{c2X= cҥ87DG3?F8z9U Dr =O{ڣq%2u!O)דea/?<F }a[aBt)4)3t!)x@ڷW6T"/(D9nBh00%-f}4U=7Ev P:9E(.\L$*ζWp˚emҢ~E~T,4uqDI Z1'jxe+Ea3dgtUl{z:iw`y=ܢ5})E t?1PI=zocrЮg')*0JH!}O>^ƒgi JbcӎiQ5N0a'i`wz̥ IwH~ PBq0B_{wwxHs~pnd_LRnT:PG 0nS+!H= fj#VMP$E^VΚ̹!Zu KiSl:)sh#BUWC֣zCXt.;ـsVIbqwj} ܸJVQw)B,K򂎍 ?.iUU+9UV@R3\rq3ـpa#6yWaZ)-/hw7b2473W5ۓ}w#jWXY\/zw"~Q j)LG8\briOgʸ{0gLr$/>4\{CtɧE9ZQ430.rU.> K$pɧ39aΤZZ>|aF"5tJU}S5>A^Wm0K#MV(F6Kܚ#C"%[c榮Es lZvLb1ncjoSbS6rLIk&%(ݱ#'|P({?3uIWV~0X9P#I̱H__"݈WwWb9-KFl;mDMدh.ݨh܂'^$;['^s-/'-_leWL_lV6лXy67y; 2u{{Ah6Q:`lFl"V^=ZQC{;s9nUk3=f|*>n_ݩk.X(uOk'TQws_N O?~#yWSUksᨪ&)COY/ƅpdd'0ߪ endstream endobj 119 0 obj 6201 endobj 121 0 obj <> stream xM9+܀r$ PuI 0)`/ikFcdDJؽ, r 'I#hdx/_o_ F?VKP_-/Kdċϣ՗|k\] vkeP/c^a Q~z$YmrYr޽)aK#a&;]T|UKa%q ȗ4 g~;.a&CGrF< Qb0JtYr..vWyS:3 M3u^U}Oz,m:@WrV]mf{D ֽ:uI_{*EI*Q$y"qgV'  #Pm\BEZ2bu/T䅨aBwϓ2r4}! D_G)u*Pu1Pм0m|u${ZdmG^*&&%T/dW1oP-* Ҳk %*r~'m >Yt/"+ [1 Vu^U%LjVOA;0V?4\rt&b%up\asiʚxZ\aJ x~?6VVPߎ]pxe<<8_!uðó $Mndr)~'m&25O~ܦmr5~B& |ݤoᝄ;as,6csFrxεqwW;I}:cr9p˟Nw}K:g9εݜ^QsvsĿr/XO|!LRȊ՜ G%`bv n"jvxБ {ՓR!% EÝ΅=\]o~ȗ~;[[CZ]) 6wzRPnmek՘[Z[1g߭*7^W{:x[!ժ:pm}MW}lWQ-a1W pGGVKכ[sqe69$*KFUh+GP%*.o9mцlsۼPl:EX;s5rN IBXT.&T//dKb. T/4/- M2` 8}DoW;6LkUmWkYWC`mpiQَxVmu]a'ܻ'Y鿲,pnʃs%zC|smM jy%jcH dZ>k銙Z5Oºx>\V碋dk\\1K߹KA\<2 V%*2"\nG/Ud e;\ PЗ HH6R?zi)9J |kEh aBQHGmEOO! -hB^`Jn MqauU=k/nSLH&zv !mP` H,3/U{Vui2UT鹴kk2VSDgߪ=ilqS.:w.쒍jʰu kaYB͉)GT ز{ЍvPn@[un$.'[OƖ&LarѕgLwH*w !zOծ4]a4+F.5X7pSN4aB]ɸ:A+"Ӹ$W[i'sNZr+&7 䌵}%y-"v<",(hY'0JZ*V%:Y~uIN !adNa>uGp ?otH+r%FP N஠6]JUu%d/4/%3;i=R~qyjM߮+~ȇ9>𘻊ls Ru8M"1gX˵OЅP٧Y7:dw\6\϶[6K Het:T@3>| JpxĒ8;EGZ,Uv9x c-Fz@N^(M x7^:渿!i93;Yq"[ /wiKbf~yh,e gR^kvC1} 8K;O] _ Bh+E"a)kta"Z]MSCC{Y>W.niI>}hx4o]CC6,`lT?4Y~|`+fᇝ}'{CaWWAXvgm,g^7;]ȹYH>׍lZُ9ǰ :<ޘYږ:iှA'O]S xO;(O eVm&RQ[惦郢//2ιN~.8Uz)_`aRߟt uwN5"ߙ;͸lܕkNY}'}5Mhq78m49;hB'M~XqA,JM>- g2G8>)Ѿ.r #ȋB7;f)E/*z1 ˚ы+zYS:^X]ы6V>Dot^j쮌iJt/*53:B#x5egJ ݁WpJj^ZK/%J^„^S^VQ&6r,?r ^$xUʬiv{cP~e) HƕX,5KѡQB [P':ª ^arv'xog7o.XOe/aS+x2_[-쥎Vȋo-y!pFޱnŽ=]X펼z yWC򦍼R8鸋qvJݸQ7n%!tjS7ngSWnMiԅ}J㮔ŸwݼqnwTݼq7s{wu9nڸ7:˔ݴq ڐݨ+4ƍz~+Zqnv4J>nܨë ~M]΋;©5ƍ^ +I[C3u{oo\,7ܼ㻡lU5 uo6 }osMi5 ɡWaNosUҡ7:1TzKx<~7 >@0|/mg.ow=6,6h:lT8 eCo66^3 eo7 copMltkwwz;ҩ./7m~e=Ưu-&@W,B:nn={7M*|~o W'ް7xR̍.enxjP)bn~lHu}!o/ ps,;dJ.`{`4luU:WWoo{o*m+g]7[Ӗ,'o[#D׷ o3[63myoU諽isu3 {.y 1u۴HwVSv.mUi%5I[\yb@Ǣmu@BrYx6Xlw04ZڃM[A|CY6W)ZkJ 'V42vn2Ҧٽ-77љڅ4%m\Hi'U׹e;.2gXk3]oڲn‘I`WkE۴6.lM[`#|;sq~1WEś%$1qIq66Ż e /xަ;Vu%I[j'm3w݆[ҥvy[fX;-[29y6<ƥeI\)keLNfpaH=UL7- nqA_ qs*Qͬ9޾x5R*"T8GD8:.{UZOtx/8[?+|ٶJp^S.d1:A؃D,e; {'xCO ^m[u5j WnXXT/Uwe:J>p0|"ƁWvCV{Y5f5Waߨ!{m-6SJG^VgZoqRʒ\Lww:+dB}q)|7`1) ~!d]T|(=*lQwz?VX 㕷]r[pa <+lN_ºbFzbʏ<=c?>ri3 r:u/xq<3Q|;f |atoodߏvWmN. a!aZ!"N~ov V=õ|3"w2Ի:/&g? endstream endobj 122 0 obj 10339 endobj 124 0 obj <> stream xM%9r+zS=c7xae;Щs޹S6a3N"PPH| (eMZbt!o.4eGK2NW5I(U\}([u-a.ToK#&ϧgJ;yY.|)TU}2 gPAFy)kUſ*PTi||m4hOZ (S]oT*Y!Xմxt'ipB]>vr%Qpg3ɢ*Ⱦʸd_%|F'T!?gU:*@| 9S 96J1]3鄜95ypNq0]"U 'k6sӃs&Vg{kǏ9m)):L}9vmhsлáaCuíq#xa{l?t{8nM{~#Cqn6l],DuZޅ.H>gXo!w&ڹ{MlOִ⸛nLfLx<._[=|* mlYgC,ɞ?2+sٲ1}F7[^>3D}h,m9٨q3X^[>e\mˮ{mm:s-w_ٖMmyجe7Fw&Om3ffm͍%︛3F7zJ}d엳m|lm}?fDZ,1}ٿŲ{ 3{FbUlY olcˉld\ϐ|+V H dehT8}3 0P{3ٖ=T^h^!(F]q'//% U;$ޙNW3V0 ͋Wͫˣ;n/g闝2qN3 qNåyf0zn:En"0K !\ir"E(7M:pmy,ΗsӇp!t򜫛<&ϙLzee|_L:UW%LV+;/P1J1lYg2e$,S!D/$Äό%߻փ-A`Ͳ:\o%pYl^yZz0aWPSՆ rj\R0y,]Mlj($prL*D`3c WkBUm;З xT]%2/x!Z\,ëI gs#:mvFqlT tzX}{<4wԗKa]VXxuX]z4@)r1# '-KH^&A:ㄝccjdJVB5gt)&&nT4ZT-S^ir& ~R*Cd=CE\]%䬳(k| [aԜAz@Wa%*r\1EW2ژE$BpMbaYKG)(ڸU\ : L FZy[:5Eu UiaZd>D%ٸ.$mD"vhҤ9ƥ(޽ `Z 8 6gHR#6[6Ae2XkpDoH6cV8`63XjBjp0e#Dz$Yu=ڰ eֶ"tGM6TaFU"Sz~9S9 h~΋PURwn~H>u= ybëу| LEu5yQ㠐eIי-c풵JʲY+W4 Šph&);LY3T@&D'\ Fަ^f4iQA?L%3<ٺQbŸ~ejŤ`/0)l]F!'[+&5q ߌ"Bbh QH^KBm^hO9p5@Ou7!d%ۣ0l͉ʮTZϟ*,O΃vH'*'gM:649-UiÐVlYgɻ [rA ;rv9-prXBgfĵy 20M ZN# k;"z-D=/# m9tT@yΠ\Y `|ଉ/؃+H2ut}΍%^6;*TLQQFEmC\hdKbcxݻU@2Q q%c$?Xi޹>0IؾS<Էs46*=p̍d]ӃauHZո>jU6-ak[@Ӣ-l6O2#,ʬ缸oR蔬ֺAz&깼s:]z6cIRj.a5:" 7n,n9\SCirw<-q,3-L8v.m_^ް,6Rr*e֭`Vsކ9>H;9eQa5 +V<߱P~_~;]:f!nQcS< SOaJh+P~JmsKn*[\g \EUSP_wk>";b915ۉ O::?V}AzO:&}iN\͢';*eTxNu^~>}\Γ?FQ;ItnmyFU3,(NY3?9}?z d9\f*9Uw(Ētq\\ԈWp!ygJ9Ӓi,.5{'s0[rN"=mILEYrWXmcės߻lǟnו w Q]&%PW}9|ݿU`]eR-嗭e(wwTn1qYzkR(RiXa.M˜>#c_gW'yLN|ղޮȒ>:lfY{zegvL]]d^]{ՒS[:l#yas[]Ws[/:uW/yėv~eP=pOD\x"w8R =DKxC`no k=q֒d.:%{Zz{naVXsQKV3(^TFѧ#PCˠ,ި17:FjR7n+^KV!|u#/6(y3ב,,FnܸKK> uc.OFGܴ.wl-C8 ʌ6{4e}zƍ*= jBZX[=k7ҊeABs6Y[`{:Ϊ4Vf5%mӃv8ʲJ5_XmەL9v1Rg!P j!l["PfCm oo͇͡6m9<+akp‚mܶ96۴f[,h0fۼ_V [rVCYg9f=̭ans}f[+9݇i[el9nB. 6]J6].@7oA. ]?]ti@ ^|p"N;uݼy pZ)xTbN6Z9_=VI_ <q=|u dE߹viqRYsMw.&OOJ^'#oyTeQ]/ra~#oȋ ől͔zOTNF^=eSu^Ӫc/nQP{^=lw4?K-Jk!w bUrl-w˖\([r:- R_٨O)unR]>[{w5dЭlRd.SíXvDVr5Q j.ޭ\ ݶ䂞S SGsĥ}k]6R6rm[5c-Z.9Rv_7ۺˍvCm'̭.ڭL7|n)]^IJJu팸u[9Ţ.q-ڭ[ [.Έm'Uۺ-U8URK(;46lu- Jܺ%o A N)88`nua8_NI8|Pe|onݾ.ߞ"uog+usH]Џ:kuWAϡ'3-ϠRfnےUvmwu 6R`9JJk!wݶź}uۖg`]Xn1렖k{v>ڥ]u.]^G9خ;;s;ߒcnҺxQW:(sU: [ co5e.Zm*D蘋7o]|D˶1)s#_s6۵䨡ԥ< ݤgnF\gH]~3-f]%n5keZ]wVk̬=s`>sJ[=-5PV 5IФN-.۳.ۮa!om -uۮ5[SvkcYׁOohEn7M 1֤ v`HZړ펳]3c̸]s^6YXzyq;úo~]m8۷%4; mE,Y5ߠs\:ikfedm߲!P+Vu$IeJşSospVۥZWH]3(:Nb-{[>%k+k`m@Mқ6#Iڢ=CWռ\JZ.2;M#u̸Kk&w՞^٢;[XZ] {| \YyMԒyYgw`;~9f$Э Zw۾^kwea=`=Y1KO'wǶ}Ak jK@^ms)ͥ{-U-y~u\. ~ rHVnAA[7iMŹO%ce}.m yU)նY[Ne+'q)НJ,S_9X+E;vr%y-F]R- vF\s_ ] wJy)”!WKve}VJwJ+Vs ri)u7n San|f]kZr'՞xוCXFwIjҵZ6geîݷ GjXإXV!-,G[r;+%r\֘ hC5ȵ-͐KOj^ǖ̝ɀK/%pY&jTW5kb^p\ޫzonn6cXZۆV r{-0`jq}i5t9\@ja~o(|;bɲexM0j lez–9T:+aB-JԖZ|OVa 9WsD-0 Q˿BoTgʕ}nՠw&lj^i6[~Ųز>- aZY~,%li)Ր%pQ{7s/ r@.l= "%rV~O;w\XͺKL-k(y_7= jG'pI.2.Jƨ mZa8׆[MVi۬9[ح, [|]aW6Nf̭Xb"'ۉ٬ra1C0FjI`V{xam\ ,GaP(rfMY d#82+ΖmQv!i;3#i9%p՚LAz>,5Ԏsl\ ÷9[%˽bUPEڎ/cv0\i&i5je/:HII˞!k,:JLhp;6j9ݓ`ij9GqZ[pvi_I@Z)v0(i;$`ֲd-"XۇۛrZ;U`ly[/knδNi:b--D"{i`Z{o:)sۤԠ]iQkRcVJ஋^ϐz&pסˋ̬ sLc?\~%KWq2va?`﬽A{Z_ߩ]V/=5utY8\{(MKLߴ:Es#o_sFτ)9~cΟRO=?O)ɷ49?S>iQ`!d)tg~c3D:sj_MQ.E˧2TJow/^B,y"yqh5Z86|H6ˑBWhiaxa4KOtŽ(x M + OT|j*_ݕDYL%:3=pDM_ WQV$u_$ZDj|__-2-^+"5I,lm"*_-ڒ>Wa a endstream endobj 125 0 obj 10204 endobj 127 0 obj <> stream x͎%9nqg=@CPH]cc7->xg.3߾C|_RVoZDX9jhKڰzM^]~N(iő, *VԣBZ=*Puw0zxya@ېWXYo5 uۡwDUBҗC*ZAg2yG q K/sSBe۹TϯO]M P,>GZβ6\o Ye5:B6r`VG+3oŵeM;JkGUUy4P&/=}\ZChtSI'%ф5 @h!0 ̯VeOtɥ'OqwԄⅤeTGu1jzx'R24"w|M>B!CH"P}kWmR_ڤvP2 W+(;DeФ,wj?EAe T_ Жkq`T;T=A@ *_qMT'aRAȾ<co)WƄm٭BBV@La M(4$D%j͎5{d+C['p`Wb;q ULi &5Px좢$=q9 m ,X>KL:n3 1 fuZ*g&5b'ɠ0f?4art&b&upasͽiʚDZ2߯_pkkѵAwWÃR7: ;<;l/P}σlcrOg(mCfc}?S}BC}>oჄa ,c F\r.qPI.|:|`"rp+A=|Kͺ`E.݂^>P -v Ŀ]' o'^vT/$U.~`:M2˪mtleD Ibmgs١7QnsmjӻӾnmlsYoosmn3ײ[`,r9 py!ɋ˷l޸΋*YE&Ֆ2^,e\l˪Y. s{n>|!LbdEjyp8׸>C%_P懡 +B,Z1X"D"< $"З- ;œOu'Ň}eY>묽\B S0qMB;q"jxБJ{ՓR!' EÝΉ#\]oqW~.꿛C]U) 6w7z1SPnnes٘1f7/^ݻy6CYuXAG/fx!r/ Is[&r/.fώ ./* m HTVJ1T\Vrڢ bmBc`N*Y̔ &$JmbRlOPPs-9P|K7@4e,` L߮~lU}^v 0ԢQfm ]AONϧ+i"TLsӕLUolhTC롦%@N֛ΘO+&)X79UR20\t t.KT3glwNRb D2_,+ʨ e/1rClKEZA*T/Bb>Կ'v1MhZkI0 ($-]V=?4!(E2%7{ٸRuVH-&$~9}= PsB#C˩ԫ"d-p!~pX]Bw4?U% bq 1<:tAV"3#*sH1cڴDYvez,"X;-~ѣL5d=[0gS|.@ #4a!cq6_NΚtX{ WH JxZ;+)VEH֚4 UV'5%T$A1NH|{v߭\]/MpsJE.Qgz'1϶4Bⅴ-3̞X-8mtT˰p4ӑ8Js^T6K_ќFX7Elkl%7,7!"exGc'2L!@#UC>ihcqDY$ȍ@}UH3eY9o0GMF A'Bپ>͆с.{ǩ\`7l+k׳`7knc%]ŷT}f~:W K]p[ "[f51%NѷmMMx Q겶0 ecs}7p`EwP ā&d'8Mtũ l#.]͖NI2GK iLoP5396YR+A,oq:F|Z \_+ V֯XFcTy5,aJ[%}u @U(D؍겏&Ȫ ݗ^ڷO?s*|Bj={7%O. I]}H4V/7 Ҽ<4%iO( mD߼YhjwO+f-\D\LȫDeqZ*=mtZZzv.uD-(zpm-l]:#Ҁ:xgVs׃F-&N>FǻzcyCnR_03U!v?[?S~xC!Snx|ӝpNF.ϟy_"&U?U{q~xTqS8g >hW_?e\V)e*AWL×`zi^|~YS)̦@S͈WDXŬ㇩-:.%^m9EjAջ fzo1S;o+駘 B7n%7Tyצ`$~ǃXHQuu_U"u?T~w9ʯ!myB7Z Cl3\gE[[1oy?l$r|v{ΟvFIfH;94f;7ʤ#.=$I,8{(r$wsO:屹ˁ%npl%9m;]Yt V1 ؅v/`M5Bň{|JEbQvM O k1]4^73P(ͯI]E`'J-EY.RTy9X*Yxy%gN$ԑO<ߙ޹1w;k)%CoXz;^4QћI%i$CΆ^JD%x@i`@|N&{=eM#C rӀ'ru3䦁vOk:BEkM@.%"W[ %)N;jE)r4zA!<$]Rfu W{ȵr f Vvw*i`מ-Z9 $$x+gbW-vn`W}.);^ 𦁗Ց^[FyAkB5'#]kZZ^k,ѽe&5%S)Z ^2^aojpV'n؛-؋: (^o[{,"u&}[7"ke-}F+:R7m-}=}E_uG_jx]{D}WY^Ȏ*m\-F_ђ.t 7Ex}Jmu,7nM=2עlV.0'<CpL[o>_Enp[^=mnxlĝ/ 8D;FE0A !y,Ζw0x$)7 ap \6  6!0np 2np 2^Ale <ӆ`y =7j79S2>Cq؅!00)M xe_ ~N op DqMY_g_5s }wq }Fȫl䍎i#v`Bȋ+M:H@O{!8RҴs/A*g_.$ uu wg7DcnfPh.퐶7mer-[yc.3䘫R^CCraoucuG\vH\5$.ivk q9'qӖt`ĥ+RĥM}ᶘ+X!nIM-ޮi\ʘ66\zMs]ꃕrU{?K|Cu{畹G2W3RqH&+Mqu,RR"w1zf/=捺Q7Ż>ဳ0uF]pPg~kx5wwE-+r4#ovlF!:*ky#owy:%o٢]]I ު"w#op%H^'y3c߶G^nkd>ڥdӮ؛/RJțCfD̎q+Jnvԥ .u>_+s}H\>E-̀UO%n&U*uhqJܼ7ojQ-o]^#qU*nIOCr.ɋWfÈ7fK^vtJm~ {Q,[HDdG޲z}tJ͞uqR:o݈}$na\6G-lzΑ#]Be-KJQ.5R"oU*ɇ[G[ZHzvgP-֮ V:ܠM3ؓd-u>HZUP#>甲&c+s(۶B VrVw,K>"JZF,H2p[RpBZH[wؽpW%uYUWma![%u˖-.ٍ-ƊҶlIݲŷe)-[哣-.S-ABFU (Yd,1cy%58ӹ*3ŶY^P{r[pVj3R?I}i$-k#i[Ld͔ֆ9kXep{ȴ6mXw^PڢJ[Jmgf;ZKjf%y۷oKjܝE6Fv\,̝5%50w_ehes ^psݕ!ucR wg]ոOPw3 8]5 y /)3~;;g(y A-$@vwH]&u\fȠRMl6Cr_۷ 8@R{H]J.ߑ*@FJ]}[nD.)\Soof4s8Nim#ҊoR.$V;k{ߓkO؛ PG {M״S+v1ɫu)yq2kVJ;F^'e9n%[$KEp+焼lpW ܝU+XϠTiD̠]!]Kpܥ.%֓CꋻF뺉MetMK⓻w*.uz(wIrw0ptw>](]}2rwIe#ٜ!5^ Aثw Mk6mԢ^3KB]Pפ@]!5k{BrOpWwi=J)|,"ry.2cܤ?pb"L<ŘTD.ϥ(+BWMG,E9&s: 6/䠫uE`!7co7Y& m[-ܦC jy*5QVkVڶ6pV вoZA:ZЪIPʈZ6QZ eBrB_!jlA-A2Q3܉ZQKwDmB+j-O&hyAˣ 7 9C\m $uO.=,U."uy*O?uy<˳H].%aYn¤.%uy2,7oURמT/E]-fJ옛5 'E\C27k"WE*)$LNyI\Xn'ij-x[B7o-Ʒt|[H\b0`jm  q9I\Fn-߇(v3?3[Yq3n;C,,.~[HUgiYV`cRMuvۗu_+p{:[9q˝ĭM 㴬=a (nZ53+[uO[;`{[-&սYnup{ր[) jz\۟+U!)pnuwmS, ܺ=Vp|[wygyۣu=`;DO`VnLVu)Ƃ 5I=V.A՝VI9#r^؊ W5^z(܎r Qj@'hu@ h9C,M DpO_O_O_9}3/όK<=ۉs <쮮,ۚcq5"|#͡|"ۚ?`_CYCɂ?>9x7?4OKr 秐?ǟ3Yq%/)}CNjr`"uOG^EP$$E`VpL_Z:%VTj\mSzAeZL%%%cI?Lm4;(Q( 4Vhya)t$@䜄yǫkB M:#yX/Q (sN)Kͫ(?$*Jp^ycOUOP5tt$':ܫJybɔ5c@lse߃Z0ٽz<9 *yjdat+ܓFޓ鹪 F{ZH1l`fAAtq4~r?6ٙ;;b~NYyQXjc]C_vqc!wP^og,q<1Bc Qg26O .Z~A ]L=ۋYD-k>sО$܏]Zr[m-cw+:CWI:Aafg~z6y5/oq+p͈+ 3v_wȿ|yHE»E7}[ ߛEv, ?䋤w{"״" iY_TGD˟n m endstream endobj 128 0 obj 9884 endobj 130 0 obj <> stream xM%q+Z@M~@z0Ζaƀw27T̅mh:dO̬%qv^j6z=oR_o?oW ?Oy:_-ǗrKe郶SgVʥG9ln=$f))̋˸tE+\8_%$Q<¥e r&嚑 \F+¥}]' իZS")idP5]j.m]U1:S.J&]6kY T:셨Qat/uEkjEP WbZ%m%vblh&V?y02P ?v}Xw!Wo/e3wP^QEK`kk2z(8{(ⅺ _ oժ,+`7D0SF44?+o56'yݧ,а63 k@8jpMuުiE5-5|I/NZ N!jw?*:O3S@xIadQzȾʸd_%|F'T!?gU:*@| 9SArSmJ1gHr9VtT-E~ O [YO)):L|wCs[ ;G@ذ4h4CǙ=xp@QG?w! =lPYxc i`g \t:í- Ѫ/Y q W=p}n. ]|܇.Bp Ǫ6I>}Xӊnh"O])͚Smr``츟m׹6<ޜ0nJ7tsmzmVklm|ϧطx |#l>3+e= ٳ${dˬXeylyX-dm`s[zm0)s9-vy-#\߱g2.Ա#5{KS.u0h^D gM>5p7W@(3+8P!<#M X=0gI'=VWΎP%Rpd>D& ^ܤcH[t~qo,w 7ql~f@ndmulmw}f_0YWwrV͖mͰ۬~%3/ws|?Xv<–a8|aH칊-a-ql9-["SZg&|`|͈Dơr.D)H+t w][ϐ|<H dF24n*יux=Ql=T^h^!( m iSmwfejfr мxLBm^Wz.r~/S_ixfZ!ij{h 7S&/.o!'QrӤX s"trn"Nsu\93 0WI KߣuE!-9}[veIX mղcÖulI'03c ]gyˎ\`ϠeYX;!C \-~_Y~-=ˋPSՆܵթQh`Xkhj:NaʎB2/P i;X3ZZ8 X%HꕯPU8pۅ+$#e09 p;7fwajFelh/CsG} pI$VB }7/&n޴;S9cF&}n UX}R겄h_[Gyy>1V,1F&%TsF2ms6q0_Ehlr& ~R*Cd=CE\]%䬳(k|,-C 0j PP+9C1Mc`"U:f pӭXzXa1{zʺo[U bd4/pQXg0<RRh ˮ&HfK̇ȡ8ׅHM!4rybΧq)w"Ŧ)ش45o͙Ƞ͇f2ZkN!,Yᤃc ]$'#lza֭n3D`6P59573nΑ\@s^:8 M\;E]ɫ^[8`*⏨+H͋%VD`^gm=.iURMW4 Šph&);Ly 2g& M0倃\\ Fަ^f4iQ~K fyQbŸ@2BbRh. !'[WLj1of/",$8YBB^jOB{*pWρCo>n톐5[l 4'>+>Pk=:hύX|p!͞LpUNgH&ESږjarS؂sp ݆-rA ;rv9-prXBgfĵy 20M j'ÑsⅵJs" W# 9tT@yΠ\a Iଉ/bwk$UE:Al:Z> A<;3Si)hƅbyCk4&F\1ZLּiwnL%$lLݩTHԷs46*:r̍-Aih$mͪi [^Gp%I_HNLZ=ɌRf=gI͒SZs`UsytƭPƒе1ܝU\twlIuಸ9sza%ʙm[nǔ%~ s'[8\RΥU:V˵U)s]e^u0oǹx.m:ꃞԎI|17f`?w>3ڏG/W xN:j_?9yO:D#u5}>cMg]Ccyt~;9C!$|Y(O%[ﮫ* 752rw 07am8r"bH86)jZߴ|* )4H ^?aPM7>_*9BSOkMpu?X١+=A~E]jAN+z&lG9wW-?5^,F]iJBWq! n#h;[lV8,{8Q_{t$(6?X酪 ךV~egqM!c?GӧfEQZs9ypv+fBw^( ˜\">OC(GdG83]Qi:i .hX#??Dٽ]R|va:$Cֶ j39/=c۟3ssO7{uC侲MC;7&b^.e=~xX%L{v]! %]e;eMxYcH1Y!\/\̯\.O5*g\uÿ'+ }17Qyd ]S&JE03K,i#}VgN,N/47J׹c+gEBJCzdC4rKrZ ?--o_g[]F7v.>R[J?̿54GZy(8Wz$$ǒ%/I;#/ SBpE~ѥv~I8~:ӄE?ג^#ԑ)FN]Fnɐɧs&JD )e-l+gl(!B9^!SS\awA^RI 1 uM*o{L6QŬ2<$}i?bQ1O,?g>ckeElO녱GWS%{К6\=F3Hzc/8܈l(P/ͶJI6X4HoiLay)t轔bzqiTl\OJ]Sr Oa;Wyv̱IVdɴR,))Sr\X"5GjI6b/uG8Ǒ$,K Gr'(uW|GxAXrܪm7`6fOƟea@sZYXA,uֺ禠wZ:NC-m یA~F0P⵹;(l>>Bx[Iǭ,-&\n>[b$E+p3*".䐋@nt5nE7ꧺnT7.=s_nw`=rm[>a6jD-pZMq#2VmMd=lVhpo-ɱ ͋F򌅶ɱ6ÅεEc6k]pkc-!kVem"AYqP֒d-nm䙱ڷDڊM&YG&2-[`Z`g%sOI6B%۰%"#-ZOI jcm򤽭OSpY@+,:~,69br[TlC iA]=Eg(ʞ r()i]Gd l#-d68.dڮ l 4B8Gem[E*LwMvpgu% [`ldO\x[l3CX7121nu)r5gg]xra o oX0&fz,?^DnwenvemՆMB [.zز-= Dj 2H5!yJ2 Sj9 $QGRqEs:ePLB64˞H@O[~ZmmF[Hmqeקfw?Q]čqqe\ZlMᎹ _ sØ볷n:IQU[s+MFܸn,P\-3Pr7o G.Qy s6.w+[v-(p=Ǥ{܍H,Fݸ%H8n޸wV]<wȻqn-;u}:uFGJJSu߂'[ :2F|]򹸋8֕K(w]dAw}RAӲh1.Imo5aDznܨO)uy3Ģ˚;q}63էJ*=1yn+1ҷ #Ѷlnx%u,K,$[--F[ҷEVS ͍v[+ý"΢rFx%Bٹf6 )Ʌ"18oT?RbD>ޛuMG2[ٗ۝HYx'h-cJ`:q߂ƻm9PTW`Y^G XO!ۭ@KZǻz'vwTu o`֨R\{F+T \D.K}%vqA_J[Y d {E_R$hV"] IC.P5D.19֊\lDS.E"p+ns唿\AkVLu ۺV% vG웗[֍;ZH3=-A1B}H!˥z1w, YJ-Z]AKe>e8I`u!jl?D-[>> jۆHE-#}eszw%3OEm\R唶SjF[Nhn՗کqaDNi.F|6ХvSFZ.6-ҪfxJ*XP)Zj`n-QZ?U5)I[(hkfER l.˫ զ֪ZsKuMނ0-Zk~F[nf(h@%Od ?UXڮcI%tqKu|,H7/?@yn%LK{S rӵڕJ+w'm_^CL+ĵ;,*e&yיƾA^ZKjBfF^k /Fտ^f-̲sEg؍ݨ֑+n=rDoZ;˚12PѯDonb!zf%^+_%`荺+u6JV__A97ʶ ,jM+ǂ/l-_xt+i+Uo;ŀo\a,޸QCxz-WEFRFtݨbM Ԡe"r&GܨEܨ{wD Xbk: GnZ 7#tzV \Wב,@ƵK~6KfZWmL-'lRm\o*:[\ȕo25,j9ж&ԍutrWeV}MknU?5!`m]9\ UKB\!g+v"5u3+;׋0 d 8[\ eKU,OB_a#;$+꡵7we7vfPz6C$lrjad@An꫻OmܙsA lktA˾@9PcqXq2U!=hO2 V},x ,ۍeo a٧H꿧`XuwZYUsniPgwտ aV5HYrj;2ޣGv|q~1Os 81kd>gMhT =}6k|K{5aeksH^sϵǏle"B_Sk~(NOA>@x'nsҿ{q+$AHo]|:k_ߺ$KJ_rM޻dN%߽wI'˻̅KIx̮}ǻ{þ[,{ %]zw5|3aK]]?Pi8 endstream endobj 131 0 obj 10276 endobj 133 0 obj <> stream xM$9+<@$P({ZFj@nk}9}hȬ) : t;hfdx/o_ FߎVKP_-/KN)+?ߏV_rvvۭ!B~^N!O!D(/U,c%%^/UK%t¼CtSmW+.a~ Ӕ<%KKDn42v\¼ ?EAe T {2@[QR`>A@M*8&N¤Ι}d0=}>2&$/D_&8ma]+Q!4/d4XдBCu$\ѳf+![e$ᄮ]%%(0(T-3-P@ғxmV< W!,{8mS` Y]?_$蠟_ErDG1 bhQFkQYbdR#zHT `0.dt&":8FX\1ͨx +#92|8mwEpEPߎ]pxe<<8aa@@l˃[6k_zEi[̖c-}K_*%t[\ _nߖv3px'}؜ށsm\NsX=\ܴ;ncY>\u;ιn;WN{g(OvT/$U. m< @).XV&ijHb/mŀwѡ"-ܢPO"W>D[E;E.~ķ}-%[f/mNQ ňy}Uo_]E;?Da ÷AgѾ2[!4we",GpY =X>;&]7 * msHTVUSpb,$E{U6i: Ŗ *Y !tMH"ĕDP^6zx!k^"3P|0 2MH^0\>"ӷk}]k L?ZT#Y$U_d(~_>+asW*]BDgl掏M A5njZbHdZv}zӈXZ5Oa`Dr<.d`\4HPoK`_z,q)G$`[aaPVocZ?nȼuɠH+]ꅾPd#>C?ڝ|J a AD`&6B6 Ih_QSom"rl\XSy:K{\ =}; PB#C˩ԫ"d-p!~py[]Bwi~48.mK4" :cy(P!tPDfF Ud1cڴD,@cy.E,`e^=zzY%̏M49 OЄ@htX{W}㰕䕕+A"$kM Yx*P GAۜ@V'wM$e>=u+WW `>>>DuW~mr / h) zb=| M3 4 [%k㩛@b42-b[c+y 2&A 2Y;#Sp/PfՐe# t6(Dr u&Pl+1g2[Xy==oz.-e5b*8&qΐg5%mA yZ4Շy̞ȶ=8t"`"qk`)aT#ÞGJ&%:emNtW=:P)b˲-iܸqn$]ӭΖ]ahhYd8R UTaWb>:+J'y>54pSN4aB]quV:)3"Ӹ$#r-4͓'-X&mrFlA{^y^[َGuF՘^!M]̃樋-Hvh @ #+v ;Cb'iWH%x"ETpw3ǞBWb߭-!{ya,/]řHJ}ǣ:lvT =%lP}4=j UR5JW\} >ͦс!sP.pl;&kdz ɽl71nRbsUzx*A$y*Ӽ&BⰮ}VlBWPՌP'F/¦vU*``eEe?ߩC;u#0!;TS$GfK CR#%yBgԳ`W&g&[j%(ty-OnjOcGJ=m+~W(}##.XE!OS8B/oK2G!ZnT}4AvTLֹ} =s8c%VW}ە+yjvQ(LMiݠzᦿa$Gd%Qy7,4+ LSY~YV~LȫDequ[TDB_oS[ʌsp%j)L@'K` V׵e^:KH5V|gVnpPJ8M8/^'_q~_Kz/_>/scH7t]w9%}>c_пg>g]s,_>]8IpX⻥`ӗOw?^UR T}U j>eܚ~YʥV߬1_oӬmR嘷!|cwLտ24&a}gۙ%CK%vMdv*9BY>kri~uq PSo%嶨;S/liP_6ٿ980RKZ*TثOj_m1n(ۯ((ܤP/qRW8?|~ ;˾5$s7~-W[8 zӀl:+A;\WjX}u7[TSJۜ&TS o>Re$Fh_&?8fK㳂);8Ozjy˲vMp Bk陷eXؗ7ym?_+3,盝IQ)BL;%i:d\W /:rLͮɮim٫Ҝa#"W*mRSǜQ"v>xVZڠrgRv-r $xD2QjFٸ4Kh[4N H}]S"W}֚J.γRrXgI:[zK6J͒JrF)'G)Zl"llmٮ Rf+EhY5ƱtF,9;h_i,.-HnnS _Eq|_6l= , Ћ^m\ms>m"CݧzM.O+ŧM[*!TBiUvchbl;g*)[}6l}t*5gҕzF@+[+)=IXFxn;glTBR FʪEկR,^-.@Ynٲyͼ`-2}j}B!m۴%8%k1gڴ1p'iFZjj$V棲#kPxImPɍm 5Ҷ{ڒo7vK捶ͥtMUe7+۾Y )=3k߬<.+=y唴{{W>^#ٛ76oi\%|4|#oҸ&x5{vn֓y#owU ywv%y#o;\.a'Ox5@{^K($qYXo$m㌽Cf]fZ,w5y˖wn޸˺]jA.g.#wUʱ8, ]erןZ ݼ%rQD#w=uCEݾQ7?nީs}&9cnp{&a#?q~$nx;o[j#o-n-K*o)?2l<ۼQVu7;@c!>dkumݎ'ԍuVGWj ]54]-vJ׺ѕIZl-unm7>oPyPa&-kP7w׺ ٪4hcp|_ zR^P>C+D Z7϶HF)aR [a˖?4,g?VgK$l5lh̯2^kK_[ݩmccVY(c1bغm)[6ͳ-eYVY&>rSb,@H2$-$--<sekںmK%k+k떯._̭o[_|>nUV2ԍ׾ŝwDo{e˳ȫ@ގ۷m(P ۷maҷo}+}Wk:w}۾o`ò^\shw7vν09Z I g^YZ)yoy%oweMn۲Fͳe9r6󶴤祑em.{[F1ڲ/4.o663JFQyZg+w<vGݶn=ݴP5PgoGƾ!siG>R;G\C xT!m4}D޲Um7ڲ^ҖH[8|-iSؤl9:+/2)s?|+d+U'nk[V]ZO۪D\תgxe \ Z/G@7w>![Q:nyte٧T->kFgK'9eQxfԠr\e^ֈ)WSd~/QWջ&%s[+ҵntU'6koiA#,njeg2a3)[6XAs#-([}BR֍Q:jzn,PHYZA24&g~ gOV#wqtL2>I~@ꐆ5u֐:I[yΫBՖRUVG׊-Ze-J[BYRgWl#q56ImëLj2 aۚB¶049Զ@hqAԶt^֮ j#JZQK+ZMزlaۚ4;#nUn[~mމ5J1j{JrIlmshۖ#P-nj5)qOږ#kT*Vkn!i@5σn9R-[M6w6C`1#l;6 l9[ZKr[r^lQP用 j6uZ {Zm3Pvj`ۘKl!)l6l!l9 [}<=N{Z{;QQ'j[qhY3aKmyOvԕ*uvlAų mw@AF\Aہ_-By;B^o邑=ovkΘm#oX޵gc5^諲x;s [ܩkЬkcv 5Zoc)ڎ1 yđ[3#CڪVu5hJà 6cO-5Ki Jۡl$o-'oM.Ƒ&qw@\>?$ZFOudjs[d.t^9}`.Ǘ~sGY\1@A|&Iގփi+.jCNw8)y |a/ߤ*5{ZƎW/Sޢ&B|1;Wvy{?lXzC{gl7!Q۳ʏ^N{?j{w??:g%E4a%9~s_RW vy%h7fyx7)~xS%_Ro[?S*|IMަYUi*rB{qAUwx)nNj#oGn]եZN[ #,BH?ɿU x)>_v/D>ߵL-Z|ݹ /Z܋=yR9M@zm.O6-}'+/'xe\T;]9ޗ'dOj߫xFxe U8DsSÿ'B뻒On.fui B KOȟ5-\}{$iQ]Â4_mK0Ke*nNa'"͗s-ym#acX?JCZǽ[2׬ijq0Fqۿ*FΎw_Wg|qMjOYQgh=v3# ?8^i kg ̵a׸ڳ?DRY+;2~3g@/ul=@? kˏ-hJ>% ؕ{ذc| uMfƆ}yfgh}>A2 Iq~;f[|7Ep"3ɺ""_)""-WN "{Eb F%Ǽ #݌wH_-<Goy endstream endobj 134 0 obj 10098 endobj 136 0 obj <> stream x\]%9}熼!IZ)؇avzjeu$YnVvА,˲,K~V{~w].Ր.a| A?}}~r?mme?KR-nNٶAXs>8u-cݾl-^"2@: 0hҷ/K @-:5ODK:@$\7@6=z`rr>!dj`FT6Fd}NYxSSy4Qb'YA Au bws&ѹ +FE2Cc 8y vҠ KƄ=]>&EaMWB2;*l{ $X\'D G3@qV;;MW d*È*9ieԌYIJrL?$<Y7:YqpѤS]b d!s52/ncxE+ ƁD߫rrخ=\] QwJ[_,/ ?E)ug ,d'0kW:x <Nxق1F^Z@=)(Af~6$W,e$fkΖߦƂ(izIe8N)laѥG!ǢbA4@}JXgK`:".WiN*k>5_*+83'b W m98%! NQX|$/; ʴ[bx%.oFlb#B뒃B%%hPsQȇ I 94G GTBaJfY" a:! #̩Ҏ9\g[{ZaҲlof__ܻG#S4n[ڌ;CunqS]ܭ:ⓋfN|u-X Ph hݚtzF-9.ۦn϶Zނݺ5/i;׍aPB[ \Ҭ:ʭBbLOa .n@ԝCT֚ ٝgX/!w*\>ǹk$L+)ݸ˚TǝS%96tH95[% י|o7%4E,խ|w/Y;Kmskƾdzf z#,w=z* Ƭm,Ug!kd,,wHf+>}S%rRYZjNWQ}[+Xzm^K=TL mTZRsk50N ŃSSKoWl-e]?'#zĎG/V\ #pӎ XB~Si8U6qBطιq g Q`D#nfP)v!$+ v_"ХRn™#%F3BH+{cdk=P4㌁ %;K pdA0`>zf<{֩łjAW1&5qw,~ [P's U" S&3]p?y4uVt{z)>8e0p6uԴP#F7pS*)@dy崖9&E>b\q|9UلIIS1sR-T$U良e(̸$3Ŀ)WB:$"~3s䩌>KG7ui%ܦ ̍S>Ilv ,dy;|0I oi!z̑I BMX&YNxla,ka,qe`: ᲉY5Uc Zhr.2͵9@|d!,EFY;u$tFА0 EcA P, BE :f|t]xHc" "o&W1ǂGɳ_o%]9 Ab`T o<_dU)WaD!H5B4FbM2d|* 5\|Ž7 kKkQj+|9SGͱy V<&fy\fX|prh#I?[vծ em:"\(à"DP4ev#Sl:9T 6EJ0]Meyh#@u˫`ALA5)iz Z(2 ۦqvREeC*"}a6$xulbMR6);$3aߤQ&`l_^=o7<Zz}$.Eu8L\I:e%z9<j}1cH kU멨`g튋8߈"BvS@3L Z&78bA xC?H膋L2[`Ťa2݌ۛ:"%HpbMiS.\0]\䟣iz05W22ltb`V}q0;(W,-q&Lv|u \X?!A|>->;2TCMO1T}>xu/+.<}r;P~?| 7e.V|qHI?OOFq>5gRۏ'A>Oi @;W44xu<硐~Ϲ~c@I@hl%u.٭W\')5+$XfBmT;{53<0u-=U(Td =~=(W&8/1-~?e6x2Jp/Kю6!OS^(ħKDz;\Y7%?{BWktye ݮc;&(ʛp);sp?)e YuLٳeM#bsbWfH[rh4 RCBOZӛƐG|vүg\'%?wxeBʘkuj]l0זG33{pP)>ƄHe_}'?I+'c ;6e t&#kHvy]k.-XR͖qŞ|IHN;G۝x%P}DuF?g(;*9ъp1Mm-\|k~_)}jN >B<}t2>*+bʅcܢ撔%Rwy7FTuBMjaŖ[ԇE m8HI/nQ|~$|- hMhib߂6҇締M6h-he eAZ;//]į~ ī_N^CR*PԱ|5 m[ID|ȁbQ8(W$9PXgL^Bo{wƏ@ +z@ު $[c >o ޛt.%>^47(Yg !: -(P%CxƗHNs+gc@y#(\KFV=3x^\nqiR(OTz(;UI =hM*7aD߯nS$T@rtEe.e*rT*?hOoʑr1D.SO|ݍEc^SѧYWrA-+绲qOq]RT3;^?2#nwvV3]g5q,DjG !zZj1c@ه@%:=(uyAᯏ=6$?nfDW7xto7lC;MǻM}ǻMF6=r^zݽ&wi6lxo^&ӽ&0ڽ&te^oqf endstream endobj 137 0 obj 5340 endobj 139 0 obj <> stream x[M7ȳ&Iр0#xU]V+_% x!n?~_O{mo>=eO!iZ}{+ev6{|[.@X [OsY&iXq4,qC)qN f[$XqYLR%1AϷ#7kz V3?3LNVHtMl4-8Kd1M b*$ ։&;T#e SMh4!`6U<:VՈԣ%lŢ8φe]5!,IxXj݃A DZ%!3rM]mu{F CNP,Z S,,S{&XDq/+РatU Y1bu*=HDD'yi΁} lO-bNG>IҒ6ت֕M $=-pYd X1dQ1,mavtD 8i@v^KT$`@%^QAMXw$ m3xϋk|!y~`[ Ep5Ѩ,.TJ'e2X&(0/2c&Imp̰a܋4F5pʀyyn o2DHm\s*$>m>J\2vJ.8g}$>Kͺd*M=%.=%.||B_$ק%.U|޻ߩy& _ЎA]RjysR4=V#U1.NLO9;tQ扅*?`^>1d+&~'Jp* ݤ9YFqUpu Wpu N*rĸEu*>jDvtUUzU%թzoTǩBjgV.p>wܝjzj^U)Yѧ7@|WH5~2aKT!xkMbXcCx@٥QF*>o0OG{GCOY:^j.WaM#͒)cv[Ȇ9t^`lu#ZhxәhpS3r/2x_d|1!E>N֙r S:q(ǭs]1Ӯv9.x}*iϰW[/w/x!+wb?ǥF/4kBp\UNQ\U/\Uñ\VGnr}$(;Ə\ЬGR%\,o986H)Uc9m=8f7{3)k£)ID Ziu{l'P=(dK`Ճt2lL 2 @cGcñVb+ |3^bJnR Mq\{xiuۅFQ|eC:8C^%"7πj}Y5#58,KԈX{ "=aP:dT푹"*א0iCYc PR~rG*`!A3?v=Oui6j̐īb6_fMfeT:D#m>)}jбT:l#%QGmBy (ffwܾʻ|(aTWSDY߾UeS}ȝDzDޘzG[...aR3Þְaof]Nt7t2[L I\$AsoQx\$9PG& a\yZΤuT}RPJHG*ŮSŕ+Vu%A݅q i!u&qcSP_AVNG$3rK'5#Wk7cMLڳQlWY?&$J7LIH.+H s<!+PC#+n !7CM>8~.!q^AK^bqrNfSޭk4Bg {<ܝɆ=ǭu.}0~ #-X[B [3Cny1!U׍(3QOXO_>APӧmX2wL/3=g-Mglp$6(>Zl[ \cW""Ѯ-yUMP`o6# >= XԨ2jV<1zPlM]]>{0iG:QَuQ$\LpD! ?E+Ւ”)sH O85P Hf@߬8L] A'i62tx|džGǯ DdW/:5#GY0xr Bnt =r)AԊݨntߧ{i>O .͚uo~G^շŠpQW$k z0G򐒤Zp6^,jo\Qe7@AR >JJ&͍³eYPˠPv Ŗ=\*죙隩״mYo$WbY ͣy^l ӬtY.0+˭Tz/+)_Y'ǰ㑟ޕ߷.+ӻҭ)ou H9~ Exĥ‘PxT=un'-;5<0ݗOM8ws__7+|ӮSҟűRÞC6!9ckfM;<͞u5yD)fc$DmGfKpqqZQj4ޟOۯ.w}YS9fstK_p'8*!_@?@wXYq˓Qq};bT|Vd>Jkkk.l}$I _Jk*kk.l#%FܺjՒֲv T}[a.QR'mmZ'D|n-mZg7j͛[-[~M ֯ ~m+]_iڠwWWȻZ2vkN{}h)MʛnR*pFeZJgNAF٧39ˆITEa"P&A3zDjL$oDB u#$(@-Ux0Dȣh>&'sHIJ«V_S^joJ#C@GFwg&PigoBN%.$1MN6&m1>3y812q%o0LAR2hN2oM .&ccxz=V7'9g5Vt5^l4R˛p/fʳ6dOPú~IvLwɦ+_Ի%W{w]B+Y%e_}Z񾵌3EbziRZr3jt6n }#?VU[ZK^ [|DGhy;SlXwlKcS} 2}K=UV}/vYeJ%؅4bvw..]kRFb.b.VSoݏɸ endstream endobj 140 0 obj 4846 endobj 142 0 obj <> stream x\M7W:ߔ%0gz^4z7 {d$/ODQEGU9qG/˿t<}Ǐ?>>|t?ߏrJC=RxGKmbyHZb=>->De4L'u'\k" ~H0dD-2~$D2>ԩdjfT!QB>E,`>d&m F`,!w%Teq#+Zf%jHE%'j>kՀÜzW:bJSęROVZ &("ڕm"@\1[0ǨK LKJJ M*E˫FIzz)dokƂL~ճqmS͓"!ˣKOE!ǪbA4@E>Jx&=o[%R2rE\t<_MkRy#db֤PJ2M1U2db%;%*q#WO$EdE3@Y6vfAO' dI(-q_ld_h_r_(| y~ 4:\!H!ș sR5kHdBngH9stpNVE^5sfn8=8m%[YW;QqS6ftܝn_\4;nwq绣ߎlvlA@ѤǙtn?/vlQGۏоz_B=lKq/<1B=  ]B'T=KVl5f9K[ƹ&ut&ང&Hv[naz_=RManJDeOiV)ЖH:$`mI[` u&2Ah¸&4薥={ݲZ0eC5n#qu3 KcRG#[K( b(z/JsN,7+`peImTm8Ĺo :^ǁ%DIz8; q3; 5BHrW(F]CD͡#Q,o="moѹ-bK9=d&1f-[6yɀ5i>eZd`lٶl/{h2/3L&+u{ew~9+޲e[}ͽL&/fl6Yag$vbc1ؘq"ʍK-s>[@~fq C1ta /9*Xb"x뎀Jػ8vI溦#! |iW }h/8YUC$ Y=1{5Ղ`,kXhA.!<1WIz3Oh_:UM<д1+Ħ8-ۆ$ÙۘgKǙ'LIPSF\&)r%,)@Li-9!_VDnxH?$yN$ϩ91@0ɤ+}uW$]r&*KIZԯ<~uq5yMF_-I]Syi'ܦ S쓾IœlJ;[k@Ul|[b~0-2K*zې_FJI}YW몲OVe0e *S_0m, >4{̰8B {%hO"Yp "-@QdEKjAL9' on#M{aj'xB3mz|.Q[@ _IU-λ~UI=[x&9}M e1G&mWf3d/,- ~tYb,+19CL@M̮<HQ5LXE)gi&iOŇ+ ;\v"$)I6莠!jxe(A8@X!XDE 9f|t]xQHc""o!bI1bAudxկyA@ <#~ȯ'؞ADƗW/*<`||/Dcۅ4, 5T5MKkQ`kARA\w[d}39EYQ6S{o\ u4C\nu?'q$N]]P֦c!\Ԙ 0F["L4ftq 6EÌŠBTo;,tI܇6īd^v0GԤ{5hE 03m~%kŗM vlN'1oYȚ(_H٤ s0g ~U`j_^=o7.s-UI >N{Q+,k?T̀<(ȂT=T)b=F^(_Э9RUtVlY~)ilv,{8`5ym˶W<@zANiO_h$ ꒦WvzQl`N%C\/a $t9r:@Z~\Ҽk֢ Y+[]5H,L jf/\_ s~G@ >E\*K㋑yȿccHo%?y$Ew\=-{SD%1>V^r/{?=Sw 4=Qd ?_|Qx@%2=2\6 q޴ʛ9o )22a+exČpSf=g嶡D:| _=YFu*X(*.Ѷn_ς-Ĥ a¶݌Z B%Hp͇|1QSS)Ls9Be{7ר4oX3WYedjtf`Vs\0'(7,-q&Lv~VsB_7Vo7?|§}7H';ji? @¾WޞߞqYO}׸~Vݛwo;^xP/q<<)׊3/yt_t CD?Tڑ Q번uV#b0}q~D& =cKif_6>E{Jq^X*:9vTL+KG7"ijg ]jG(qt;z8QGc dE49'دYϖcG_/{=_79=]3xes[62GWX1O~&߈Hmݛ2>RّΤNr x\vMߠ?w}l{b_wAh[׬d ڵڵ,tKޯ\dK<nj_B{{ MMi{N860M{dD\ijo s^ &b-?~vs }~C=ڄ^(MO51[O6mle,czjI;­ ,I|j]/MO5kkO6i6S7 endstream endobj 143 0 obj 4885 endobj 145 0 obj <> stream x[ˎ%7rWZ@o(0%/y4Af~dxުVu%' `0N0xvw?_RB}gʙC 5o?Z}g+e6r6[|>[.@X GOZ&iT,T\o'8O.8A'Vu-,&XŰO j@Zkz V5 %+gTk09AZ!ё&6YijrqI/c75q4]Mv9~OrmHAsLMfyݑc%]H- Z/РDX59 Wz^ ce P% Ō=hJZ 2.הVs(%uɢu-"RgE 3Q6? mvJ'PuL"%{P A 8D&6K+h;2x&"iIڨ> \0i7ų>M[`Yޅ[B-u&nPA]x7̝(|O1=7;Fq͍*?aޱݍo Y v|o}c_`e Y&r9k|˃eH4wrUq-r47׹\]VIMwgrT[[ζfnp.?gޞsy aAVj>**:#BM ? 0@ҥ]Р12İ.< ("N· Bŧ"r,c{d5 #͒))z[ȁ 1t^bhu!Zhxәhp-E7o>w['k);QnszcJrJ9 s<9n871[7Y| {|o YoAX;y ;*$lQe/\Vñ͂fG,or/(ۀ H"g4kQ%U [.Ңno UQl4̓L5܂}&EM(@8VDKmTnA ]"34ߦh&`Ѥa#Vci"DoLJE!-Bbt0CaOV6,e[Y!b#G>  B.Zݠ|(WQ)%#|W|HUbJF+u ۸504E P]=֭"P3?qE|I_'z45K\e-֛ޢd{P HvKrIllζp^ʅ;v%<Jx%n38k(cFyTmfؤZ9UQ-҉z^C:$;`S%/.Id%xU.]ɖGJpv4譁j@"kf`Jq:I|tƝY֯_Ըx-`B'bʩ8Q3v}w >9@\\5k| {%Ou\ 'uI 2VN /$UJmD?YxſIO+8Mͽ%;˪oցl-*7g]7륲&tJL&³eY.Qˠv Ś.=\* iJV.^IDi+zTG 8Y 'iY.0-ɭ_*= &di"{G9@OQ>^q JOc(Oz*=iO?Sacr)]un͊n|ǔ+IyJi$s˶"D4"sq9^?\YaN`N+z~ITO}LņzJiTW`/UT5Zn|rї Ք/K%Ņ3p*׌55yvw/d, rp ־f*[Yjy އվz.e0n _;:啹@|ݒxKx Zȭźُf𧻓WKVF u.u{T}1R~@ߣ.ʪuݺ ާk7j+[jѼ+[j֑sNywn i+&1v}T9Ժڇ8yOOlq)}1dJ<9SuV%IW+W#7L/4s$顼Qzi{LoNٷ{{^7{#i]o]՚WF'}d*UW6]PJ }Zzg[Rb" endstream endobj 146 0 obj 4701 endobj 148 0 obj <> stream x]ߏ$m~ ̤[% ᐷ9)#)zz/F.$"R._zYe/.ÿےs]嫿lau/||%\.?KHσۿ.ʶv’R=@ w:Ht|r|nKϞhT=Q[1nn=$ e0EjR:F=+ciN |k>l͜d51 l) Ytrhɞ'M" [y/d(O'dIP/=.gi]ӟɽx {2Y~ 2T:LL# !0hl,y]:!u%ȩЎ1LG[[oaвhoD/.K)ELXf66cvP2٨NV D^v|6, Pм5uF[nsMPZނyk6v02 Cs5n'qY&fvv&78H;8UnME˖:~qDjZ\a$/{8֓]NnzB a.8 DeiFC)8:`>46) יxoW)4E(u)5:eOOGl/1~58/`&0e} 4W1g0Fncz,62gIɔYќ˔YyLy}Ƨ `D>4eA6] rה32Ck˜w2rSLno-s60 3ŁSUMmCmW -vi]7&zw`Ķ`-.>8it8 ?)ԀCm8 W;۞Ei? A`DofIvm.$+!f(x/gٟ V_#<E$Sn‰=GICnpH8+{}hk=R4 %;KX}'o(:foErgG F1=9e=mU H6vY'h8e (u)Lݏv0c$ gE^ŒbŌӓFJ 6C GXK!JbareGj|)Y\DlI" EP9GQz%)xi-Hn884fjHR#ւ96or70|fu A< YLY#CE>Mr,r`#I;o[TWu)MRoE>=B@rJ<_})V܊Lw&zH\<J啱` &ru8 X tݦqvRe]*"}fV/Ӊqj3$ɚ _Ʉ sdP"`*|1p?r5)^I^PyS^8q|q TZeО vX8 c羈uϩ.-d34d qpan},h{ xiH]uFukYp QNsིʆʼSyCC~wLHѝ Sj y]S+UYiWkG±#W] j]!S/Z>`* 'т2ո]$N`s,,SIsCxc13#_,~e\RiԢ `Q38[]5*I 9uh8smdM펀N<}Sa0(̍Fz祙"!E>o~d]qIhhUE\LX#c%7Ӽzǩ}ǩ;ANf&˯KQ,K r8$RI| J7]:tH.$4Ez&JeF*g=;qPhG}b ,N O#8n 4.Q,ޞyӚ灉”i23yjUE2P#6]GGUԞr9gazN1reUFZ:kUg;N fX'!ކYG>д rNl > xbbKc_}w3%bHQUְ6s'pHU*슋kZ\n~mѼHMr_܇ ] ksn}yoB?@5>R1B?ӂCz\ŀO/Nq h YTi~kV65Uozu?4.aU1ܥJƸVb=!2ַA[zҩYo^ܵ|tИƝY= tAmt~C4_9C;Gw0Vptا7f[&Nw&O]O_Jc*۸g3rsF}^zc_y+6 ̤d̎ivݐ ޙlLɡ'M-fs7ع6v_;^/Wsv̶8db^.eٳ%@O;yg\|bs7O~^Pě1s'tqAiVCmLG k:EHC%Y^WƘYtmuƭhGӦ0aeߐoU k?g;t_ac>յ,Ô)jSZo+|tŞ^t'~(,7Ùd`y{>06B{FnbڍǮ Сs&Mrۄ@DXcyZb‰G?9?vFJX恣?G}E[~5#s;~-jv @PKS茴j]pψ)gtFХ5^ HP茴j@A-taFy} E|3:%Z i}eE(W@9S>W^k7A9S>.-lzUM9M+rFg}T $m^-/c^(gtJ@҆fy0E(GA-~/\j91-ř:m;BG@9s.cZ ivBP@9S>6m'Dk)iIk\ sPp3:%Z¸=%Z^Bƥ{PVH _4uGftJ@&dNIH`./rF}P pqv|½dP蜋TK7IBΈ- oצX>%Z>;Ҡ91-fj|3:#Zϳs_~ >&kn,2D _襜Y+i~#JY5KɳV_?;_G}so3 H8OȼTݚUf pw+F4'eV`U@Y~`Hoyow%g l!OGF]S=p靬3ڄH/]`M» 쇬`.Vvr'zz\!Kw(kK-l ^նuϤ_sýqO9J=gHc !3.>?5p$aw"|CZ3:{tY9RMq$%o3KՔL$zf{aCl= Ybs?!/>]Exr_xt_!E'p~B 6R'Dh($<__W0 [OTWijD?S#$b1rtB N~lh HrWHǷuA_@Mt(=Lw֙ސ*q/cՍ=/4NVWhw|AIZ[v493 endstream endobj 149 0 obj 6913 endobj 151 0 obj <> stream x\M$9nǯ]}K@{yǃŴ}|DEfVgVd4P/(?؏/;u?RK^ 8ٿ<_^RꍾnV量4zn D3p<3/u}H"sďm,a}wTȶژAvQt@D[tP;< AW $L u@uM;z Һm!}Д.F D҆em|S|tǪu>G)Ѷ7i< 'N:$Ou92-1$mK@22IG`I2쑾@ad24F"dL}Ȥ6lpac^MKVV8Ғ| C29xx6}mO_3DA}֭kN۝ٯٍbK]6[ lۛ/ , q&t1g׳:]-lmKrqsfO|q``A)|X%Xl696 ɄO .B.-a) l0x q ,M4kы0u `Mh&l| Ov܄ /{1D|Jڑ-ʸ\#ls#Z%?/1JLPhS/#[2C7^dKd#?=e&v$*ץXIj&42?|x*z/-Db*yN}#M4)ت">c|.˃NeHU)`OZW}%q}0 S&NR9'̏s8MX.τT+RβR@= q.-K=pǪĎīRbT5M62^܆B~bd@fi,y %KvYh\*a@l=ZO\u9MՂ]aCMKC Ebtx/Y}&5o )SK/rf2`8[di..,b*uTzG6^d2j$fD[C2+.yNVATi*3[:26@ߔpZmDg6Mko0S^?|U5/nwy_>C>ӣ˟__NA{5v.۫~&&Ǐ_ǣb}$]BQ@s~B޷#?.q%rjD?~(OL|Ч~~V;чD vl!'p d]ͧ?@WBɮi}wF7\QU`UVeܿ<57qvtnYa~x>8"(:;àY2d477yɍ"A1Yݘs^4ް@ڑp,5m*ݡZhu1$mڣu no(O9>.)$GW@s%A(ǘƶ2g@{}[z>n1]ԑny˖ĵ7}s ucD "/i 5JY:mG, '$ 01?翳 2!w$hgEBpQ~,[=0s@oPƁP'$7YP7$#^S(wnR' ?7딚oS&9OyqH.nRy񠖃里CɛܞSejAO[IZsAZV$jP'QshP z,^6nszҠU$jjAO[ZГxzP zn^\wS}j7V=;:wQE}C|]w:wQ׉>j¾E6{!A<@ ۜf8u(/K' DP}VnS}p6Kr%gf$%98T+)ɚ!%u>|v581"έrEJ)z`im ^BA%+K'Һ6"΋K(}A}R$-uDł\|{}V,-*/ϷPl4/gpg)3^ȧfYA}EwI=~B6#PwcA}R,1שw7@IX#:|7ohצssZ=2>;Kٟ_%y +g֟K{.?% P.iVut@83 @ w͛ݕq(6}K'pGl8lH[ <ָd*,.Q%zAwIXZ㒩hl8(:\w}R[ T^]I= X\_^\ o rE遥5JцrEwIXZg]ss8p@;9j]k{p绂`qyeqy6R9=%ӱJᄠ;4R@xqrR/w"w7H`f/X31owy*|-MVэLwgĿrq{x0Ltltˍ! v1:i @7\}xT!ޘ a1~= ifBlASuG鶂}n 1esqtZweecZҵzGʘ"Ͽil;;&@֮wt=6:!8xDͮ}ȿ zmVp땩wJH?5U)o͊_  &/ghGuGK]G-ݖ< iN]lk_!)IAc/~u"{ƒjc'HYg=g/z<#|"a# ?TDt} &S+?1W>߅|Ћ *]?>^ :AHQ{ˬl&MvI+_LdMzUY8?2. Gȗ?SSP7}32e᳹|\OȆ:_M$/G_t\N(95D~PvA\5'wO"N1H#h^ {F魒5GTyu5|9'z.bKT }}q,pFG_uSh/-jQxݷ-ܷZ(d"i| zEoQokоA3-!=P?O7,- ݾ9ۑ/U<2ނߤ^,$֋ vU endstream endobj 152 0 obj 6168 endobj 154 0 obj <> stream x]M$7W@Ն%Pn/074v}A>R"33r0X``:^EQ%ޞӶW|8Nwq\۩N_o?N嗗Ϳ~~>~*N=S nnmDXs9u-c=vj92(Lh T8=oKt.oiws!_ezy%dNU =7}OOóamyyŕA(  LA_ [` x D /U6Vؔ6-g# K}e :;@aAk ݂6KdL-(HTAMM*[zVhr`Ze4v_,aΘ!,HFaf "% >[wQabق2K- TT@ Bq`1@ y4T2 {L`Z& zhCgXKdр8*g R"32Aj0y!f, k!'hNmFU;$u_1#A—$#1ok+)/πy0$ $ܤ qkd.*хd%s5 /)cxE+q"bޫr] \jbΏcUxsק5nBVvK/ &mPZNIE  %}LEQ*+VFnbX765TIs^& srxeH󣩐QƗbA4`<E+YMz-]4sR/:E7 *P6IG9Ke3bJA7L1U8,d!;]T✏\ ">[Me&-5wW`L2qtN-X8Ь к4El9 [,cA=[je vҼ,ڇ|,8nuj\sOfuv78H8UnuGKf :vqDE5U.nqxq}6r7Mﳝ[:K(05|a;5tYCcG¦`h0w ͖-H u&["Afĕ&45z]Z8xDKi|#b_"yw9oL ;L`* m,Yg!kd͟,sY1͒9f|&K%.di`˹-z-0)39%ּے[ru&gr{Kϭ8/NmXj(uþzkHAǻgIlj_bŕɝ8mn8T40h1v2)d] Cx͡#Pe^?x_sG(`K֘m8'#jYwsLFiSKLv֘m#spM$yay5Q[%=ĸK+Q-%^"cD>5b|_v<’ap6f$\Œ%ᖜȒ-P¦mRW xY@Fk'fM^8'cQP0[w8U${ӝ.l4>Ґ4 %+KW*pdA0`>za[d H]sGmpHdKO,"fLmSd|ԣE:Hvҫ*ȍ/ٔP^=ϤMb&-D Y^Nlb,XL52 k+Z":T*i#i3*ha4&FF%4~it 9T5ف5 jB""  mL Ad 8Q,}u?yx!gz[9Ye_ۈDlפIf Qr>UZ܊qHƏ#I Zfۼn(onAgsb qDy:ʈ 1e7B WDO }_LmSY]#m\i33Q՘nQtмEmtyHnETo;tt|GvHt?1Jë`AELt51RҜ5hɢr $Cw)REH*&}4$oDXfMDrX e @`.e9+'w@ w`,!_~̼Uṹ$RlRNb'I{qLLIK_CŨ:X$@PX2XOE+[bWԄʼns_4% dir"܂S,W qGZ dhMJ݆ದ% 44GY+.k?MThlA,Ye$ !uLџuFܨ_CSbqqZ1dSIp#m [|'HylS Z٭'yUA_ur3HBU IJقyJAbœ3O%tm9b:a GZ &N>j>⟢?$j҃ӹqT:N5f\ Y"NRq2M6Fk7Ceg_MZRƈcf ꨽ 3KcD}̸j{I%~5 ?Q[/<i_<%=(zAыq].;nwz󽨚20w㗟OJ@=\$>9g C'r 3XbSbƔeO;/y>Er#9%R 7KL'"$)mE )"ľv=o{şк6Ra#VgѢg GiKgH(.Y?zRsmP#vƃ"qӔ4;"kԉO+uWΠYJm )XRZ7ykPUR>@})iz#.:0=s̃ZcM+=jAsGZЃee05ɠiQ~ M+=Pe0on2ƥ]7.q}o\E}Â~/KotEu+۩=wY3\oGAur꘽Zƌu[EŊ#*D U>6Qaǩmc]mqww:Zo#z;#S2֩ B" Ɏ1?jAn8.!O.|(apL5nC|Y2l_29sP θq%qb9+#:Y -:}wb >y~aOT+Ipg)y}ӰSDg2AzA5[}FYrE7IHZцM.;L[,YJޕ|"(Gnj`iHŇ/FY~+IՀZ;IN.*l&r+iP lfd2}P XLI ec\M>6%NDgor>̛%43%F, IDӂL%9#+nZTp08*y!_,͔M&lY=>,͔O䖊PiT/[,sf$tGüt7Q>@a.-2>;KicIO!e+aP ,x+g.O䣛r,w{o(R舌`VV!1|;/tΊYe.K1p_5f5伝aL&oi6=F_/ٚ6l\}|{Raj(@'";t[:b{5=:U NQ°}CzaXa_;1L<7wm;;\];MGڲ0akٸ^<qL#g##Lc^5la aΕEtϷ#jg#_ ZXLn_|weY;th#1]Uy5]*h,כѥĿvAZݾNδA՗I;e KS#_[rIrs"> stream x]M$9nǯ]}K@{{iH̬Nd,/(?=^Oo)x=5VKKJї ԗF wPq <1/u}8EFH;Х; j#^`(Qj!d}`AA01["֞ƏkrPI/ 8dp'4ԁA# 4 )&ʢGT3yjb?@bRPp f4xyYD@m'yvzn%JT7V4eSL8 QVs/ e*d#~S$~3/ɌD3E&De, Ba8Bչ" ) ,4Iv^!ǎ `x-GG FxˣqG$  !l ȏI{΍LDpBވOsei@! {U{.W.*X&orf2+cy3[$˘&D 'J:8OUDf vc^<#SęIH_ )qh8/rLjV9f4ge"-18Ag߶}gx٠lֵljWAnvRlf{6f7~q{0n6]NiqW#SMwvU..tqn!/n NX,!0e)1PI&|l`ur`l N܌gmgSK`iY^KkB%5fS} &Tlޛ߈& WҎlAUfIύthI,cD:6+I3QCMh>dzC7^dKd2W^dKdȚ;jo_dKdU RYej S0Sh䢪b-K%hNS׹ZEUIM+5zUoTR!3նSR[}xQ! $dFܰBvlG ] W K3p#rE ;] E.cӧ͡:`~M,νFUXb:NC}OShpܭKdC@s8^`h!&1 vQrF3R?E&?E|d &.lcxyʚhnszL>t)-9ɭ4:ec&OLngr> r8>eWd۔+/%C"vs"L8pb^dZ,BRET5LUsudM\nEo`!:lT 77p)TciMsp[,H8$[IQ t+,m".u>d Q>lAme2i8(K+(v˷s Z)WQ9 t7N-2#5(ԺU#\͓SH`_J?C\8VJ sYh\ox,T(H$*ҢQ [Vy]Zjrpb];]2/T`1I wɥc2jO#n)xA+#d%Ni/0TC7QC]$. [P3 AD(6yTJ^%|E(ҫ#E5i#brN~% *j("u/Ǧ\)UkWZ\+fP/ 6lTa*_[(CvL bC\nK'9 /1!8Ac @+B(r M Z8ufax/m0"9Kd)^-( 5wd=c!硎|U@D$1x6Â8OgMbfe8V 4 O[r/ӑ%N~3bɉ8@$'Uy:͔P4<*UmUXyhV}u1oHIy=5wtS T:7@De Y&'m@VƊ]* 4ۙhApT-7u'7DM hé? #5 7/<(m&A *r"Q|e zoNj6BJctHTQ{U(s%ұL>3㩸˽E9j2/ [l69z؋C1NyHUurEc'-+8Izfaxq*xqNԓޤZdy&X|m, ߧ,Qsi_ʁ;V%v$Z$ 7IVLTa<6 X2<ܘDoA#,BvTI>Ge=6&Jmc;l'H_R eɏxvJ$qJky$9c'L# O 5}37ёZrKDOkf6aYYKLy& Yz*}̥8^+v-:Pmj{ ~9ټ>@l=ZOU.BD&j.0Grj?H\o# /%Ģ&&X0?25g,VY l9^2k"@׋Tj6^x<j$fX[C2+ZRgO$_Pig;IBwƔ xvdn$vNBtPYRCZ.`PLv#z iKTNng 'XSͧ{fdtĩ6{ѽE(͢}R$m<&' %wPͧ{fTwZ;ƒ$@+kR䢌x\ݙxtCfP.i\t#OxP.iIk(K3O@\]>ָQqvn2I=#0y8jQj괗{\#hf~<}|/1 Ik\(WF3?"SiIk\(:;G@JrEHu7=-# M1\I= ,hf]GV^P螰9= ,(f\fEu=s"‹㓢|)盞Guﳠ/XέCaegE qfqѸёG3?p{xi{<0#FZ5+~m9#΁?uM:8>@Q\~ҎCi5З6הV {elTjQK00onqjΕ Ө^o`8bH 4oe^|+4J-W~4E7n]Ra<V-ak.iFuoc{9YvL\<6}8}8\FE_Qi[YM- ቂ8gV!FNr\^gh/W:A2+POaZ MFמʖ/KG9KY)zd m9wJҦdSu?6:ڜN#+Z\Bzd+\?T.C`OE\ϸ5p[w1K+ ?)^Ѓǽ'eԋ3$j~-S'OdrGJal}Fw<-N\~Mk'ѿ |WlO_Z.w ݓ{7t 1,zj7cܑ鳙_-I^xtKm6[֝SǞ+ȷaˇ}Uokkw+ WM;UkA1mo1&Za?ւvK}E9O-.}H+-/_*"G^҂Y-}E8פ}λH{-!}8͠{wqGoA_@,V4y/l endstream endobj 158 0 obj 6182 endobj 160 0 obj <> stream x]ߋ$9~".ۆ{`}'rdfUfu.2P_,˲lK?߷O{/;*͟_?W?geKOO?u/>߶___Nމr)Bz?}l+:o[XN_O5<@H'@S;}j} D⑉;̸΅ iEOtFc :iǿXjmÜ1I!-ړFaf "%26[wQ`bɂ)e-d'0  ƀqdq%U=O Q"WT,le`.f5~˯Sc^4gdJa7'mg ^U:~42D%[ Y}JR& [.S 9g+}e(󹈲S6}rF7L68,d!]ÜE|$/][j[B_3ے8zǥ8KqB_"sb U-&HQ"Pb\FlC}62%r*HL)NpIf$|FCbV~=}as'Gx葢mLmf;LcܖsTvLć)Z&0$ ec,(]hh]Ƣun[,cA=[je ֥yYX.qmXq=1˶4AA:NƩVwkq.Zd̜n .lnGt;ŭ56Nvtcժpql֯ a fXK! ucG&oh-ALD۫WĢKxw#:^O/gl>"%.u<’a؎/51sKcِ5KOȹ,٘혧͒9f|&KGKfi9]FӚ.$LЖڶݖܒ39<[~ۚ S,mqTiR7y .u;S+. d~8LiGwq:,\R)9[qwX.@=CEӉc,B&]HFk \/r&X6>o߾xF|DS dD-K4-!jim&;Dfk̶DsmmpM$yay5QƫK${qW%Zޖ8zdDrm?|5[`Ka5#*,o,mɉ,U.lj&}|`캾Fx"}L 'D`>J fevos%jYC*x>pB`eip%Z Nϼ'ZMy2 [P,h\>fتNw"~ YP& U, mS&ӫQ]f׈|, q ]?-&)r}|Iax0M{('pc0,)@dx% IZX7 IXt IM xƬ`}`n%YUJ$}r)䆠Z/~e 4fHܖL6?]doAоKa.UVJXH@Xe`>56g[dJ$nCjn5f &i]M8Q[A#);a6La&`^1& ;|9(^:-lV#2@Gl-Adsļ$W1I| oZ$5㘕q@xvm#% 6 Ñ;#-I7ɒ0yYO"fEPf I/m|I2x&uW3 6m XMr"gci$ƢdIHN[ ѡRI@IQQDQU0?25jUT.I9NN3SΡrd!ĤIQ;'q5GP לg-HDE:|4]8>3hcd gIbc[sr'zAlTg6$$hX G5pҬ%0bL vɇ#8 qm4I Q4\VOӉqc"pg&k9,  02Ȝ ; ʆ wo,!_n̼Eṹ%RlRNb'Q{aL牣Kt_CŠ:X$@PX*2XOA+[ibWԄʼns_s4%/dqr"ܼԓ-(W PЀweKK6 6d TYP/d8k2b@1s~~ M)ǑOWa\bsg_>|E,0zY~z"8G>A3go=G>1θ}"XRk9ќ#f'R ͷޖ:"?pe"5.,"~To$L=QxYdJ[ZKui~5C)P8!zae>I LL7;5ꜽ$PX;w˼X10(}cwTLDl_q@:˕RɁB_M}m'JevS$[W*E;!|Wϩ"wtVOK *5uFuIJ 5o< jlC\.qҖ ei1VZW9I8%ex3>")~W7*ثp'5g5У5Ѓ.(jz@Nu#(1VCZУ=e5УyObP=σjGQA jNOmݭ ˻o\C}.wQ߰ Ky.wQ_]zoQG~s<:eK#"I}CjR=z`|CwR/ohNE- Ep~bRGÝi$!}uQ|3RSP)cR4@1-2% ,]@- ϬpT+I)+ŊyP&iTKW/>x1'&@}P ,j{98)ݫ>;Ix|/Z)\nj`igV/>9x1Jr+Ii ^R'P&iTKڈ:/O?x1Jr+I@ҺV=JL[}T ,mf 8NCnA5)9O ^R)L}P H$֓M7]DQnZ T/f 9$3$j`iMtPleY_M>,ݴ7;Ȳ}P ,b`wm. "0}Qnpq=| n nrS܄j\dϧ/ t>;܃bݧhoA,Gt{XZ\S?X(nA5f-ÉqJ_Vt<;/fMݸƊX緥|w,ϴX7ct7݁ '';r`w΃z@ß*: Ygj*'^^>t+9+:`b+-Lqcᘕ{/)Y^jfhrNfէ+ (]s6_`ٺt%%S:vfO^/7B w k K:p]Rwp|W|?Gx:)] ^|Ib.=uui7/ \Dn۸).i?c{Uxn}~iӹnM=^i/n(U˪~ Gʜ׳tӝõ,8Ҽ@wF*l |ԙ(7M48hWs e+eʷerގvQhad]WL{|5޿O/!=G|䃋tCut-!w.N7,Bk@"|.UBwN_ܥUF ߻KЫ\Ȓg+S't\ \q ÉSE ǟ E;CU?C^>m  )a{@F=[1qB8N<4kqkZdt#? Gv ?zBΫWQèKeJ<FRIVl^қ+~_׹H2mW%؟ݕ{; (&+=X4w"]ķIYҙ t a),mVzlKyR$Y"_,u{H;˛/ݧ\k em"{T$g|) endstream endobj 161 0 obj 6225 endobj 163 0 obj <> stream x[o9_Q-@Ҏ[obo3= 2HHx=m7뫢((wܹϿn=廲vno[wq/)N[)ԻF wP>qw <1wuG"qfxI|gcd[mvYt0nvP @B1o[ 8x847nv1^B%.o(`GiiHRPM@'EMT3yc?@bRPt g2x^yUĐ@}'4#Z@X,j+jpKxHSfSݡ(`HZE[* ;Ⱥm:MV-@ Xl }m`%4ev4eX0'h A [n՟Fr3ȹ1~㕩N!9\YP@={.+*^,ipd$W&fH1MhF@2 7>+&E]=0`'Ls9:9z5L8&%hAet sQFw)k`}6GٕWbAa'qEH,Su _xV"+@qj8@u+p7~q ps̍1$X$η ]2j ݄ +d2@̀{ >OS?&GfC"o\bLkd 83 4:%0N E0@ΘȤ688ΰ1s/vӜ8_ÉNx6>}3D4zh󶺮ũܝW 78/\l6ٸ: W` >LyĜPZ #nGHGr.:A}: l6H8K`K0b”0t_C!$iEe%L;p3A OA>.fM0z. mׄÛ O!)^nP}AExo#(Ovd 0"6MzCKe6ج$D E6ܒixMxQ.撅j~z\MN{.y!k|ʪM}/9k^%JB /S^w:EDk'USoY*1FsޘEԂLԎ.JZoDPZWJŋ{,2S;[jZm;UL}n-5g@Bfj >*oǴf+Tt{50@ХpU:W12,Wİ.ܡR("pN7 BO&7=ey +f Y2VbJ,RrlEqnRvUUl ( Py*P؇C^&<7/3^%Td:G%sbx *8T ^Y{D5$:̸lZavFslֻ`tXƋ]xUNtoA@lȨyH$둛U':iVjDfp@ l>5mVZ-( i3/[rw KfŒq*IN 3 D6SB@`HT TubBR_9Ycސ;S^ T:7@De Y&'}@VƊts.քPL@ pU-7On>ЇSFjn_x.$[Y_PP>T:D%m>)9ѱT:K}W:P"]+qd̼8>|1S|FyN-k6Uy MD8Ro`H|P% K8C3fژ%Or1pȧ4DEK7(;b`K))Af/#߉SeeS rl9Ih9B R@8wd,P]m4+Qw.S3S<ڵcv-R|͈ -;Mۥh#r{&'qq^FNOQ3ڰd8sԜ7ٞ v$eKvslQskἔ wJx$ڕ% 7IvLTa4 X2<ܙDoA3,Bvm҉zlVM$;l'H8@5˒"ЕjI!HrN8Fz;A@"kf7ѕZrtF%"NŇ,h>fnUdOp>d 50YՒ.>@e.1ZkTЭjTm~놟+1Y݋D6ѣ+ZgTb+DiT-7)IF'ۈ$Kvz3ɾ ̟VpG;KwY߬qܝu](5TVzO(<{^\e gPl -˥T]-3mC/._~#>|Cw~4gu/llc؅߻]{ǧ:Ç||#mFTȤAާ8qwkw0'xpx7&8GEH1F=A:wr?N)eb<[OWzL)/kjז$]`.Ezx)?O}m c.yYYeAU,K:\-;Tyt+F-Zb̩ڹ.PBfإIΌ>aL!3`NB[ g Z:huufpd6Ae UWwxy$#qY]`Q:{]#@SzM*PxkJB9_D5z<6w['յ#\r˟H]Sf{ƿ^,oWV+~1]tCbY@cH<;,VF҃;4HgѹIv=\xx1}ȌGf_7#?uG60:i;LM2G 5&vu72˾t.K?/eT{T~TUo3ynRq*]H,W$dIm{R?w7239%3xpystmJ|#dELpAo sKu8婠z:LP«>Sg@\;Xke8@PS5\6~QR 5YW"WZ M7PP3z/jxBz'@%KfNԑ>UjFE-5vo>)F&ޛotoՙF&SB}&ſGm=KGQjx~1NnMdł +-NFX'} W7 (\rELF|n|K#(!`;L<|+e"5&O:W2O?'|>h'.jE3`~Ew>DO5|SI.yG#PlnQ{qP"ˣ{k.TdKǞ?=|((g%g\izuOLW - Q i}1S0KXa-7̃yD.ZAQ]?.KlMC To%> stream x\߫\ ~_1 wzۆp!l }6Їҷv>IOfnnnB =[dYdOr9ƿåp]_޼w\ۥt ]zut?w?/\1zI/1_=PmayPZzpi 3A` L0;k|p]ѩ{F"~P0hD= 2D@2USCN d25nO̠֨Y!{S0߀g)*‘?8Q=uS4b'^ Au"bw9]|?_&E!la;hy~0ŕ@(L@o [ <v07N+f H)7jTȔ\Н,dRTkԇWOGZ.  9,0E ,\C-hGYQ`FA,x օ+IGzbևQ4TPXibVxX^^Mct՜ƒ e ʦ23?پ@_{ЪP,qPlAY=ؿv *`: 3ARoe2"Pɤ n2Of#@Z6UgؓlEhܝ,,r7`7ARk_LhFjg6*@ٴJk2FP;@›@`Q%'#1T17Vi_ g'@0kp55F p515j$MZ1<$PAfF} h9s *ƀ+9=^i!s=ܬ$ VBLP+DE'@pi,c`ʨK)%a%O&DUUW^RFbl`&lmi,Tk夜oެ ZCzz4p̊)Dgd5yxzL S/@`}(椲#Z󥲲R1sR(p`Ч*Sb21+'K"p0,;xE ʛ ^2&j^Ȗ8/6/.9/^r>P mџB=lSq/<1B=  B'T=SVl3g9S[MsjZBa$sl-nV[ޗ{X[*Iž>ҍ[Ȟ)Ju9ڒiS0@@Ωٖ.aؼ{[&Ld&ݲTg[VkݕkveOoWnɻ9~[=.`Uܹ`Z+U=U~UVUcܹN#sLȝG[ei9ݨF^rk[\aRfjh[uu"L ۫q_XJM-/{a_=D;u ^ `<%pҁ XB~S(U;6qBطιW9(IP 7S(FI QQsHz7IOoqo) `ܞS D-q[VyK )ǷٿƲ{ "**7ʇj"[RZ>Z@~fqX cR)7ȗHV[wU޽/wDZK25|yiWq@$|I%&Y X 'uϺ!XP-J!&ُd qRJ2BY}df5uM icWMqeQ o7INгLLÉySC8HȕWImfWNk@ _Gt5 ^$_NU6F_$yN$ϩ9q`*I ղz&\ ət,&ja ꒲q3y)-M]ZI)(s4/`o{=0!j-9Kzl|)[n|5=2S*zڐ_FF.UeʢgW@vp C=9*˟9P8 .;XQ (%r3~ނL9' 77pi'ʸQwz.L8jGl$|$W,f8)b*H!n * r&BLe_͐+T~$ɲ@ (Y:v“g cY c+ը$d/R4gt&`&fUTeT-,hFʹȴ~OŇ:dT_IRl>ACpe( bA-O`*RX1 @%y=< 4NO^zˑ*,  5R-+F~ R{HHF *SSCjυHFbM2dz* u\|ţ7 kKkQj+|9SGͱy V:&fy\fX|prh#8-Iyjjׄ6m,339՘ aQԼ\NypaERo;LtzGS;AY$rP]%*@zPoS9AMFJZ^1Yjum8d5AŽ]nY5Q_H٤ sTЀ"0ApV>yuR՛ $qa/`:O)(ayUQؿ8@RX2XOE;[lW\Ԅqp_fAf iQaj)Ի}yaI/  !k(YKI#M6T*4`"2;*Egȓ% 49+UEiŒNIc εdX ɛ.[z. nTϋOد M.jq5o@+ iF8f u*?$Dw (_J"9r:&@ZAn{, y}˺FUGoʢC1Qrr`sh- K }ϥ;A_mv7dg7/Sy\d\6 q޸/s@ndR2]9 U-NYՃ(4̭Pc%tQFݘ-b҆ʆ0eanNHt 3X"iS*\0 ]_R/4=oXVcYk:i30DZx,0(7,- qMaa5 O2cgЏӾ[ђ*x#Ea&Y[Pqސ\0!ԥ/P80CqK jQ,!W#2@(l@rG0E zj$-w y'.4A!WCE$v㫸gO~wjn+%c,6J cO.b}ܿ@]i(S_F4Y(eWiH3bmII6FJG;*5ڒWm'13:hCwHN×L+_aƲ //SH_asH7we8C= ǧ1~B{u jCiT og5:uT5h%OwWEk{ ;ݔ9XOvTl!gaķR:v\y3dom) endstream endobj 167 0 obj 5032 endobj 169 0 obj <> stream x[ˎ9rWo(ZٵG<@2н7'^nuI*{e4s ``n?Oo>P|<= oC[)׭ P'v@x䇾z#.@2IBaS2Nta5 Ycb*yP } d^MA,/erB#Ml%gi5 ]R'oj[WT!i^uN4 ).n䔥m:@S'Y|ԱF= 4(`+}Mǁ(}6,C*XE =gIcR 4Y}%Z-i kj; 5JVwdѺOf`3"L'O~Y9H@ ;m&{P A D&>K+t4d~ju>j9OĴV,muN%?mPiw["+to @Ŋq$`ѝ`x<6h 8C&Ƀj~;od9Dnѫ(L' x@&ZcuS'<oLDӧڠ&鹤@ݗ4k 9@ Z75P ̀:[5VR7 4Y(, UXsk:$myDKh2嗍)QtŚT Ԋx tA= >h I,$[5Ǣ#rMT 2$aBoLkgm@; XPQwڨNhtDJe W+7#* 7֣x4)1ZSP$QTg– ukqS*01 1V:5 N:{dhXo7Ke$4cPY K}4"A-*J$Xqf=kVl JfpWo  YI ,5$Z"w.d n‚x\#dl%@~^4o_% K&3PP(ڀKFeui/R̤FX=):0Ayӌ7LjCc^5ʴ`&Sϳ/o&Cd.@}Ρ.+ 7!l]vمP:Nǃ;60숹=Ct\2=6;G?*OGp`tP_}M6$\҇SbqJ9NɈKS6\R $ɥOOnR.ҴKgO|2xI)t٬KFoSRS'ʗ\nT}IMz(<'Ճ$f:h7{2G1$QCc]ϝr ;tQ扅*?0Wior v|8+B7iNQT/\];\B*1Fs޸MՂ\ՎnJZoD=Q:U8U\TUjۥ sݩw:M0}z@ a~9|NT!HK,F8v 9]e"SPA t7zD>1purNT?,1vJ`λulHCGUJV9b(,7g.>>#L_c Cܰn}3O936 S:q(ǭs]ؘi7 q;plc_X|> jrVl!?s\jbMCoؾn*MU!ITMU5{*ȵ:buP˭~ ݾz@ D@N6~*f=*İbyy@ZM*0mq90a;IYMN$J խc{8A ]"34ߧh&acda+H>>"om*ϦYV[Swe͜@>gd*~<LOĥs'PM:1Ta7w<6g4jlT" u=k݅1+V\)L>א, :!u.+Ts]zh)ɼy"VGJ^"L旸!󛬩KFi t3wa>E>ʯC%K4_cp@F& 4IX36NͰ z))I++7s{mEARۆ @UbP1* $yf@w~(d.Q#bAhyH@PG \CÌ˦ =fy hW<>CK}b7Sˉ= YuB<ŧdd 7b3Ch:<|95mЖ0/4 iYW^ +L~cEDN lJ*}ƃRhՌGA堫O2ݹ%Z y%=S^ t:s7@z2B xL@> =8𺱡*=K#7!f?=HO\D/& Y0'eLs!ϒ?1̄:72!i[̟L!#V4as.:j#]\@t55f T廴E *|xΠ *C<%^O[8"t!vIw ?ژd Kt0+_r1pȧbnH"% η{#:%:\=u661L/."̳r&;kRB:R)v%T*4P]m+Yw.kP7HS4juP rRfF8:]&#]<%WXmrxdҞg"yD0ЇX%QdM=G/uE]\ArP\YqSo?!{?w \P8?pt4cOBW@n]<ك0MV\H60GMhÒc*xі?MoQgm= v$e;O%AqwU6ЪOgZ8/vl $<j{SdYVEqPǢFyTӶrgуb3lҬI>҉vިC:$G8`S%/)d%xU.]HGJp~4譁j@2kfř`J :I񖑧=6<>~`&"fUOѩq>Ȃ k8rO|%PKq VFuGt+&>KJܬYً~^}+^ uI T+)IEO( +o#Loª&y`Zej,1>YV~ dQ;ۺ(-`듫tja(<{^\ gPl أʥ>zMKܶ uHr5 F+ޘܭ}CX?яwGkLD=h%H)2f/@SS^ǧ9.^D8v?yCďW%֘)b?0lgf=<=ԢN//U-Dou'{,?D~@V Mp#/ďXlCt0YJMaO4ZUYޭE<^1].SRA,t/ߨ??w+;^V6zq J]6~&_"iM[y:i} m8$]x&tfl"Toe1FyTH}ؓ DZid)2RpyΨ0l5;*{B疤r_b73쩮4Щe5nbu%,qF$c,}r̔A2_ Rp D!PT<9#ny"*mM&m]Q :@ϴ&,vuֶgZxP*϶(m]=i=\!-_bL-Z+5i*'IkA:WZ+ĭf~_zюnj0=_4 Cw~A@֖/ ]ZԣՏAw*}9<5 Zᴝ_il!~]N$QU9v@ΎgHZ_䭉R3/Ȝ[D_(@@B3z<^ḳNrɣh>4 >A3z^i5d)qd(OMu'SL "g_k $BH kUGeD24ԃ G}Lg2@1A1>1V-5V:|b4}Xcr1duLlqTZ|lR-hqUi(> stream x\M&9WĹr6$ U0)ðfZ_[$ˑof]ð04dZeY%9vQ{8~_q>\QCz>p <܏㷣|G awl$9Ο] XOG@ &L sz'C @=:uODχ4@$.PK OWO&LNrNOPq}RlFd}NYlE)d ,Xd'0kW:hE'@qiMWȡq>R=rrS6srLM i!gNNΩ8۪HثfN} td{+ t>|1"Fhg;͵wq&Wt5 /*p#IS1s*&yN\j dҫ*}uW$Cr&*KHZį<uͲ1WÖRj;v} @ 8ͶMu H]jGmYpԎHJ/"f8)Vb*H1 7U%,e_͐+T~$ehAPuƲWQI^f ֜aP.@.]QYHQ5*"M*? ʯ3Ձ kz$%4LW1H (dV"H>:._$1`7W1ǂGӓ׸J!6 kB+F~`{=$4F, K*SS'Cjh(v)dɀUS*Go<@4/EoLEjTz4]n3Xy ;SdkqU8f*b/mB q}'>$"]tn3D9#<Qy! 6Aќ߷bšZ@9/B8 (T|Rhj'(SCd^v-a 7IHIk8ђE p]g6K*/R ;vHM'qƫ#,gk~Y e3@b}P9S@Ca*|Vqr?q7AI^TuKQ88 |q~q6e Nٮ ྊxϫ-",d7 4d iqan)o"qg xk MHToYFz8\*Hmplr2u4>Ps/b)yPz2aRzVݍQR[sJ}>زS؂s$Y8pkۖm9^)u;9zD<}mIM=h'!M"'ÁslzJs"w (_J2st|ry]=ǧXΚ ^QTPK'9L(3ЖYAen|15:<7͟<;.TD%1>V^bwP﹔ t'(@S mG})HF~uE},˃Cơ@"U$.7ϛTyⷹC?G0"3jL*#ܕmjqt">etҖ~n݇4ZBeMݍek£-+&mlKfԩ .aF6DM 4r9?G8\lmqzi}\ݴ?ǧmRk>?o #9UO0mfOT%wp,tAL/&Q>k?>~o1LZaI&YipPfMN Ĕa_ynJEkZ5BYQZWeBW _O"5]+*uKwWS_T{ow`H?;Q?\Ft+Ԍކ:1 NVP z#jުLm77S۵:cU_A}*;u}t_E}{]WQ0勮ۨAU/t((ځrG_\H:f"Ho*c?ʘPL@{D zW}yA9t9eBL#^pM߳3RdN/^r@_YaNdAn)5DKK|:ØrGwFy\_GEYN$p)**U*x_ee#{oٿ 1 '|!9֐=eu5hFc^gxF১̥p^{4φF礢iEyW^ K 7^/k^Q}^H~DWy;_]ޔg.7Kb_V,}ٗ疐]L\7k Ve3Q,eKǧg)iߕF(DZfK%Yf8d7+ӻ bd!ѭݒ#;:Lo?~vs:}mx l1/u!c7]_Bſbr2t.6Eo@ endstream endobj 173 0 obj 5117 endobj 175 0 obj <> stream x\K$9nǯ] ǴyǍE}KHɚ*d v;$")eō忏_.]ryC$/?D%p~t9FߏZG+o:2@s !bq"Kč3=ί9 08IvNd|nb(Sm| )dv 0 ~OWJ KS-@`rA4frq1/Ѽ!o`[fXih:# v!F s~|6:!hA>;Phz-TLP$99 W)6{ aeP K-YP-$Օ@k5ee"]!(KZE>k* VH 3R6RܩsSF % YPxdA 8%6ryiy2=H(mt8[ktei#s(KQҧ5-̲Qm*# .(fقjAN&L,k Σeme X-ā%~rdpۤj4_Z%DKlnOY:%OMHVr%&6IQR+O25kY5)~f,5PXͣsd\c? E7@2ũ)w8*P=oT s x=oy4GlA61v(I@~ṡe zEKi,muL DSJTjU*nU*/VhJa2cZd˘&&<&@i?E枀_ H`+LzpK%}`a)vcsc vqVM 'e5{̤WoX*FR}6т`xmxYcaWIKmT# ^[DO0jI{dg%|%L+dZ31u+r/aq p̍3I\,η]2Ha'<2 f@-ggwLIiȑkƐ  e)%LJ@Y`Jy3o23VnJk18.f._?2"Fhcw]S;;Aq^7lܳqۇuW~lk9o=mWF[ܱhm 6Wuݐo[58lp b 9`Ą) `NiB6H2ac[v V =|K͚`*LXnA (BSp& 7aF=QA>LQ,¸\6鹑mRXXdHV%i%j(b5/m性WknY槧WoΧWoٻ72[`,25ꅩkz\UHvrUU1cj4ꍩ\U|L-ԈL說J35znTV!3նSV۫}xU!$dA1-BEx@ }D] ߤ 5#U=."_)| tX_jy]νNUXb:^C@&Bn55+t)m9ɭ4:ec&OLngr> rĴ>eٶdkl{ʃ Ys竬گ0yPËkzkB Qj[%BkW S0كVAՑU7Ar}m$<@Gtr#WբHA 3+nq;5o UX;inY9y3)jn@XM$յbA Y"s:P,M[.ƴ 'Uz @beGZNJmܧ%WQ tN- #hQvgpWON݃m`/:NRDtU':*V+3*jT–'9kḢZjrpb] v @mGd+ɼĜ,B^=.ȀD J+f [2ZbJRUq~Rzլ5b̅zQ|=_[CW$8@ 3 yd:G%c 3bxǀ?L]*@/-WPPmf\6hu3KNrn)f);/v]5уep .'~l: <ԙO *L NHӡAgYiY0͂+}eamd{_VQ,{: T RGV DVAS@U'5)$%̾į󁔔]9_N z((LA$ ~c2lA\ UѯT:"kBi3ɂ QIMXuw)| $4XHʣ_ niBrPI&W^UNFRXcj#t u.$:Vy]3}!>t<.r/-&b*FyN'[QFd}+M.gs&O ROH|$j%ƙaJ9 u8Lr@a@.6/yr ʅO10$({sԑdS)r3rF;bk! 9p\)=ETf4+I-u6U 'u*~PPvA8#E&9#s)$>fDMb_hr{GNJ:"Lz=/X%5.i>ԅTuq4G]5$qgIarr"%XH9^8 ESr'WU#!taTp![ YP- ūqs.եfA_<зIXI>f,)<"P=/R55J[1:V+}9%}с%cT2Z'YyfH>6ՋrH헁b{E h֧2-rG"@S-&Rbd,+hx{| QdeI[1FX,_$+' R' H;*ceRp\ ' ^WTK2G7z4Y3/ōԲ5 q:4>NJG>z6aYUv*y& Yz*}_¥8A+v:lf{ 9@ռ>:@l=YOU.BDjE~`u$uF'ۈ,vxgfQ-X?25g,Vyբpsz)<sJJ鋛Gϋ˼LA2lgv/rpuM]]U-3mY?5~ (AYtk4"8xGsC}(#KN 1/W:_.Ӈ'm$4 F@3_/M>>Xy=ӻOX`H%ےiJuքt9Ҫ=+$ uXX~f 2?`~bDM6%sؘ!6Ǧ=}!e$XL.D\Evoֆޘ$k}"Y7:YH&uV#=YyI9R` \ҝ@7E% ,xÜS?=ytsn |InP8g/Ļ+|͋C9#ƙt(z;P3Qi<H=3ôb^qų Bi%w]'=XY3]DIiDFOo0;P@G@{?L (7.w v;qFɎBN2Q@l`Ob8_#U9x)_N^k0MҾ8l>7^W endstream endobj 176 0 obj 5560 endobj 178 0 obj <> stream x\M7W:ߔ%0`'ˌY4f7IɦH<$Eﵯ{unQEQIr>_}w=?>|r<Osp O?=Os?~r?ߏr)<#ߝm<8Zzz g< L0~Z{ E扈ĸezj#=De>)dj`fTY!{S0@f(*#9{h<ϑ9**vUT'r.y73}oH_1*x #+19ބqM;i|%sh1OOM~/@"Óav&a+P P!f, @ x  do+RWMWȡq>R=rrS6srLM i!gNvΩ8۪HثfN} td{+ }c72E9n<!7S=`*};xr%*ZvXA4;fv %b!]1"jBZ/&-61=n"-ֿdlsKahֲe3 hˍ.YS[LvmK^g&Gt5 /*p#IS1s*&yN\jdҫ*}=uW$]r&*KHZį<~u1WÖ.v?`Aq }07ֽs Ζ%l=6>oX ӯ1?9=mHM/*uUY'bhd *P7e;8`Co A(y$Q= h{L[ 9$"F0ܴ.^;*$S@cMԥv G툍$",bnbE,⋤-S|{OYX"zߏ7u"=b`'VSaH?AHDl.|?Mcy[OAeO*4Bd5WVQÿI}oZ;)F5}vaإ8Iq Ҹz4ן@i|) 1?uX+{ݛaM0n;j t^#VX03x=!t;"j35SOϝq9~`c]{jC*'i{.]krtdye ' r..2cepmxfP@ G//3/>BW bH۳3$#w1~oWL_ᴝ"t2RDĚHoG[)qߥ9Qǻt Q'h(\QKMy.(.ݥ8G tC6]j*)uEQuX@4Q*uFj$@^:YjFDiJkQR5/@Kv^ZxĪASz.9ԏ8o|5>AG,suϢ~Х? 9Q[pk+j03#}qY@`ZA#,|ۜ+0*H (5M:,T_弧9qh =ꁤ=ncp=>iiI |N#RwZT#˾4m3W&4[TkS>^ރ.XsB/bL:,T_[]/V,Zl_H9(wĔV,V疆SPH达^}ibl܆v9sW&$;(wĔ, K f-FNHN:,T_[Z/㽖DFI[P)XZ/a--5_M<"։j;/q_K - @͜;b/zBsV^#.p4ԎìǏ9Ol}YuBD o*72n }y#FozR f[;LJ24R/t2ĦMGz?<.N{csZ}y)9bse,\^ӉcLFtygɪMN NJ>Y5UjDWc噬g> stream x[K%ׯ{ډ ;Ob0c؛UungVD(a~k{qo_wiu/-Ǻi<&p}k1ﭔIekmR|[.@X [Os[&n,\o' K'qr:}sfXA |;A\%d^MA-/arB#MlōS/^Ɣ758UpZ HWD`)OYҦ4e4qbgg#UJ( ( 4((`-}Mǁ(4!we d"YXj݃A DZŭ!3rMMmCP!iu'l*<M,BD44? 4 ;m&͈=@ yl =M @1M9`wV@ Z#IF>Iܒ6ت֕M $--pYd 8X1dQ1̺mav4D=X7I%ک &_ֆ 7&&<Ճ,`k[cE1*s3o$Z7KV\Zv+d,TͭJly.-&F˔]6ZDakkB |P5D`S+h/j >h Ihb|ۭO Yt:TA'P荜{,httGB $j6"㪍(pZFËU:-NZU1Ѥf;Z"HBQh*WaMp˺8{`a`)Ns dssjNq6MV!J2Ζ=5R>oɃift^VkVvylad‚U(`՚k%2J+M \)D0TYq ̍50$Z"w.d n‚h2 f@ϋk|5/ɑlehP Xe%%LjD'dNE7LFy 3o"2 3vXnFk818)g_¾"3Ctvv]'vqw_ܼq'gܰsmoޡ߸!p:ܱfG9Jtw=Qy:BO:ȧrvwk0 >Sq F\8s($>m> \0v .ų>%H߽ Ys盬:B&4M$JH[f{*  $y7n@wM?s^2 G4{ <ġtJ"*א0iE,8~tXL.'zz 6d<$ͮBzS]45HPNfp@ l5m0+4 iY^ +Ɗb%8@ٔ U:YJ(Hl6NRHʼ{vVj/8 ))}{8%@3Gy dYPFA1B'^6VTf T:[Bi3ك UIhu)|SFjo<,/(i&Aߐ\Ȣm'22R :6ҐJqD$ꨍwU(s%ӵL̛=+멼wi)5sՔdQ.@ַoU>ci"DoAzC[.]]JmdMhJ%:8+d_r1pȧbn"% η{GuJ9JwbrYٔaBE|FpH~S #K8 %/8 ESr'W`M#!teTq!3=h xu&@!t~ZҷKƏ]aI>4E P]=֭"P3?qE|I_˹OD(Ԍ6,;N/35m5&۳ lg0$6(>Zl[ \cW#Ѯ-yUMm,+5c<I[A6Vvm҉z^C:$;H8@5"ЕjI!sH N8FzkȚY~&7R+ANhed͆&ie6ax0Lih#/\e!wKw_ PU jnTW}T@b鞛} ?+Wnțcd6ѳ+{xr1(\ԕN:T-)IF'ۈ"+~z볰ſIO+Lͣ%;˪oցlYF]LkWiqsyq+2(0ԟB&+`* hf5-sj}eQ*[q *w^|0ISxaIAp Lc-ƲO#&͐hqr :\ >dtR !Ś;_VpA#e ޺ R[xc-S1Z[Z(Qtd{^C7|g⸳Z;}GŠ0oP/leo@OYmv B0Y<<<}qM_OJ+o~zX>]R0RMs,2xs7V5ݔ] :>+[*R']tX:[߅ꌸ:>vq1_2_L/qxt@j. Ur?or߄no ݽH7 x7 wCyw9]߰Noz'eڷ7HN{KA@K_tR=&BN}sookz ~otF޾ou-F'otWVopGGwwk;xD=3}JvI58o ˘kWD?K`ơ'E^yC贾[R׿UD_q0vG {3o>3JhKH XǖՅ^y//XR* 89fYL*mxSE*EK]K[uڪH9FѼq%u.sRX71όFU(t7oI=h&UD2UV"8;'0~{osZ==Iq A#!%WHˊ.Ob:VXgW~:j2⮉a93 b ~ ïX0/*麸+8zPC@4<};w}/RZeiﵵCB^Eby"d?I'b Ghy::#ºX/ۚܠjZ\մIڙ BUy' mwuH«$1rFO23*D(8W { `+IUr]Wu///a0/dXe"mߵU{w?V endstream endobj 182 0 obj 5086 endobj 184 0 obj <> stream x\]}篸4&c+ț7!طK~uNh X 0sX,~>qW|nw].VCz{|W|VSx-懥?Tۆ`ѵ CPHCv0(k!]'C:AݟZ7A@2=zTrErvWM}T9@Ԡ2jNmMĊP6Bqq҇?F^ ϣi ,تV(9EߝYLg]1W :NFFvL7l&tk̓aI>,1~OM/ ÃQF¨&aP 2;Y'Td/ auqh; M1KgT٤cO SPe,՚i(˥>D"`eL"E@HAbuv *eT&0LVMAMM0jNUn>se85N 5t:L 85Xf 7,Q8Zj% -(k*p.UI `H۠LRPidA/2 26Gm>Þ0d+ X2̰o `Ym&HWk 4jG6U$@uؘUd&K o18eeԌynMcת1,DF &ntYXڤ5i)J Y\2FW !)D!j:kՀ\^e ~Uٟ"zP$ X (ڕ2o`@`P\ۘ-mk t5%5%眠)IW+3`~(׃ g~[=N*ĵ@rRnoެ3Px~fE|rfCc>R=2SA2)u6cr+SҘ̜8̩mUKZ3sʲloen9"LѸnw`k3Ntܝn#h:nwq绣߶lm ٍf߀inZlgssxmsnl܂ݾ5oe;%0Æ-O'&pq[H;[dKd*[[ v ъ3eÿ{{iQw QM[XkK(ldw M`v=-Iž>]ҍ{Ȟ)Ju5ڒ;iS0` f[Haؼ{[&>0ny8M.en^+5k>e6_طL*A^Gw _0Xz8ˆ,Οl\66]yo6^ K,m6vzm|a kn6Fn gs;mLk>n̯9["`Һ~ F^gq@ _"Е)7pf$bQP;ҪJw1vI渦#+=ɗ,]!^oxh=łjA b kh~ [Pk 諤5D&3kh9P2kFݟxd}<%8DZ!4\MjM34EȒD+fWD87%xZoȉr 7s*&yN$ωT,T4^ 扯e(T\VL:*HZͯl?A]l#ȫ37uumgJ:X 7}{lsVv Zx%8{l^(&XTiCj: ZLkvu]U׉U]4:a>: vp ߄CG{s,BOA{΂yS&h {T])F-_$8I7Y QԟW &cE[@tqH/L3w[kb1/z4px^|M e1#W4$Cל,-:vXX"S &!{m%T3CM`i**{iT3,LFgEcdZksZ@)+ k]'II g y>pe(rA@ C#&"8j|$ oMbc^SUyjAH HWz{H}yՒi XeWaDSy\H"+i$#Y)TE&䙦ZTngo̙:Hj0h=cuLSl3#+u1b-4B1eh#i=[Ҵj}&ͶmFx?5B@A(zJfj^no726Gjs^:dVz#0]6 htyh J˫`S=AMs#V,,Θ;.iUT_6:vSN'YɚR6);ss6TowÝ JO[ DNoRΓDb/ND'!c0s\N~1cs$*`@yER3}7=?"B)&bтP[`=ł$/zRX7ju5(yn-nRi. 4GM7TZOㆊ0]yPsgPs5rp~a.MJUbSsY8p1y˖s9)v9sO_~UAouiw d%!Mj\6[S)%!@H(:kˑQ1jƠ\xY)ƃY_pWp Adu(HQsh2; xfPq)ƃ<#Gk4%e9p] |JD `(K_K^#\6ɍ(_@liʿNڮڗog@r|K(u 9Risk_O6T~q\4#l Z/ƣe;\U hHWdGC|.o ģMk<^ԎoTQEҞф YVI+aH%MV5&k9`/aM T-(3^bksI S0*>1ȡGz[ ]daz>W8Se%,B ɜ\yA;vv$UI?ipGgѷ/tt##|FaFIeInY[]ArUa?Ov+]; _ka Q 'UX8[}}8X8xOk-reWꯃ_naܲu)QO4?4sX Q pEMiXti_Вxml:[}F}p|:Þt&o/|э^BAHHz ֿDC_Xd$V[l~i9 /msȞ)"Fngk'?kXהll-rpk/m{܌يA^|H> stream x\ˎ%9nWu% @fU(wqè20[+"ͪxe4;xC("yٟO F~?[[Ox/Z@k_L0cѨ(.T*'E2Si1x68FXm7aQYJ2#9d`<~aЉQ~lujpKH=[]xva{I\dY9cR:C"Y;D*)\5n>!)RKZ lH8PrWl96nE+6_X]J.WʴSg/|1x*㡰tլ+F/eꡀuu S }*e+]"R޻߉y ;z" .r)j/H]qKp: ݸ9^Gq^w>ȥCKW[ף9uo\_q #rKWIMNԝա{txơCzgvN]8ן;v=c/DBV̩1**&C6 ")B.>ZAh9Vh؁!<Ҩ"Aʷ J OG{mFC,ΫAUXb:AKHdFʸQipݭGdCA:rhmWR:߲d_4 4uU Rp.q8`ۜPCtP[):1.a;\wYJ7o29zWGd(?LKĥs'ПM;1Ua7w<6g4j512-+j{z̗H590nDp:^K2/t`\$7ҹF5l1Ƙ ̇2?BVa=Qlq[?2ZdDV]AtGɧ7ɪnȆH̍$sDW@N`A%z))I++7s{ZEu~lC{BΟ-4eWh7wjDw,~(d/Q#bA큈hD1 32wP%3n6@Юx]c’"J`c7KFP5/ y O Ȩ< Nl tx3j7 -a^=єoH*~JxDVƚb%8)A Z"ubW3H(H>NH|{vyK\Hʡ#z*tDTu(o2X?590'^g^6VT`oHM(τȞHw\Dύ U0'aL{!?2xԄ>72!(i[̟L#TF=HD]@t=f#J|z*仴E*|pΠ *C<&^O[8"tvIO ?dІ K3*_r5rӁbn("% ʍo1GuJ:\=uV6!L/rYȜI^0DPT]!U+ tWJ֓ ԍ+ʔ]4MƦDa|:(Y;)3"M&#y2_3HK&~3nҴ>A{6h0Cb_`J"t4d{4+_R;ǣ540r#8 C(~:$+HsK2B x`ӊ=q ]9UܻuFȞhFty:7-)D0xZҷ ǩ0Mj ǺUd 51!U׃(qAL\可82 fnd|63=u&dzjD]t^K`OrV:B wJD$:r$P4OpW8؛"] |,bTjV81z +7vU A>RFe=!JR#pCv04H*BW%!)Jp1 xkD5B*k&͊3ѕZ tV-N'{lx}ZYMX6^̺~g>Ȍ k8򰥋O}**☈ڱu[1!=7n?69@\X5Dl_={ߚ*287ZҒTPnVF^+^E-Miy|gY:P"یYV]\kW Vݳqk2Q ?;C&k`* LukRx讋GQZʬ^΂hſi6q:X6LKr/~ UBO۷y/s/a=پ~~?ͦVֽ)_>}חO9~yeg~? _'_>Mt{x7s&~o w|_^sOI /Zg&b;=~7 N<{V5tY-0+v,~yc$D"aH)p77 s2Q ;Uj,B9/IwU@k!TLSmٔըz X,C]i.?UT9lҴ荙s&X?i>Eb߽tcBboH:=m-:1Cǐ |T-{Kٟ3F)O?{dܰV?3.!q[t[#QIPH`h'{Z_mg3<Ʊ; sK/FrpY_$عrsy7~=F1;elw+5+|FvYJltǐ?<Gg#là#Ǒf`D dZ'FuiI64m7|fȩg;|} t{5!,u#NՔ"*dpBfUi688ϙۍjPܓ^c'8yps5OXUgm;tiPM7`>re_5)_i@֮a]fa2>ş_E k2!`yE.bftQd&Rty!qWJ#l9׻a"K ֛>ڙsS~.FW)o u )_'Լ0,iIʆ{z* 'xv.st~}7Gag/۲?ؠ?dgzL%*+GU>z6NB@~1~:8Dm ƣ@\Rgb!z /ȐIڝmfɑujr?5L>^/z>"}qϿ|'_ v\Ү~>Gs=qL6YCƜt4:y/ZMBi7N%A̧K諍rs~׹ׇ辞z—Ǝg`nmu#W>Z7R{XIl C3g08e#gjt7h,Nc^iL@f[xx$c[wWn?rfw6)G|" [I7mǩa5 v=A3`"]ݙ3f rG90솸a|u5@_|[?#M^3&8~\75o:/tQYu c ck)jhn F&t~ԿPP>Ia}s >%B3¦+r|q e`\@@C\A?=* Ej듦ެy~٥S> endstream endobj 188 0 obj 5572 endobj 254 0 obj <> stream xݼy`Sו?~[Z.Ydy-˒%o~ml#y#/xWHRC6@S.IIL6NLm0M&v:fҦ &=`~~zw9w;s>+4D52s/Cy0]MVዄPu3wy>!L6!rvԾ`= BԅTn:v`_c|;v-4h~_1~GGҲ]#7dd4q~Ȯ-VlCqrfz~gJ 1fn|{˺70*!,?iqfX\T4Z7MffOwdd:];˓/Pa_c_#쓾0눉H{+Ob@O2AN%? o%t~Вɇ{ONO~&\ OOA=1@cROj?Ar({QӶbp\w8QN4|pI[4, G>Tih\򉵶u]nJps齫SFR)OD 6!{nMYٿsç4"IKYRӽKXlSWےsoiw` x& 2فG%Et?r7aSWK>2\JEC-JXRtbJYQ[VkQw'?B TXB!2e5AMiV#%2y=&GrSssUl Mč٫KM>Z.5Kіk[W O[arOB=o]" ziE+ZZχO wu찧JF rf-i:!*to{CuOOPu1mJbňXSFR.#%H3@4j3T2[M0I RY@n~QƉ9j䎧4P%gnIkdLLd7=EIc{-Ii Li˪i 4-&br󓪧AL@lbb'pTdB[f!\>KS&FC4E-R PŨ\&SPĶ@\ Մ#g;j/QZ q-Yww8qF@䛂sX3F gm0Ko,kO7$- L50 T#ӇtLk%u!0D.E^ D+q_(|>dW/.]9ZړUDʲ!'ee0AKMN*j]fo?z;TWXoݺw7*J˽ )`d5%-)1ʵ:j`ԭ'޻o,n鬷v/VgU'ٯxG*n2\wX7e[TodT8rf#H! 68 TNiiic)E3LhF4z! cQD(N76L5itt$3.o;^o(A;QX-U{f墐Ԗdd芸 Q]UMD.NؙR8pTGE(G]: ĹsPzb .}Zzg!.27GdmniIYgUJKr%TlUvg M)e5l8ߞ8y5/!n̬.%kYxd?4kJOkGyK33iQJ{*]HޞRgNZ : k7> 1jkO^$[o-\$ۊ%M $,ca jӄjbBJ#1aNK҈p,d8 X%qRe#?8o3$x k.iE3m$B+mY%@{:& ,fRѼ(J2VIB%l~=BgҙfeR.*)N)h%Al^㸑2NoTWJXX%jٹ9KgDYp-\s[x(,S0iq1;iQJqmѫK*/Uuduo|6cUJ7k펥5܆}[°>]%|~5վhvfjuFu'hQ,ӒI);C廦:.Amuvżq/tz![m/0^?ԛ^[/<Ǽ H`f{)¿x~ꅻ/4Amh!*W7.)LzTpqW>s}TzDzʫ奫zNZNdV&wwc7dUy"G[{ѝЦ;oٙKWrrP\Zy`Kqw΍m:Z!lWy Vd2pD6[( Tn]AT1B?Eh !U2C@+au$U 6QcgE C.Y{|A~F#A2BoN|ѷqN9=ì#jJ]E9%c, %u[.WTJL04EXRq!SJ̒1 K+ XPI)ك2!(d`[(pP> L!yiE\%S:XbbY.#0 ҧhQ:ø5e %b4aHI5\c f_;h}sH5.rgg?-*7 n%7w/$ހOBQK TR$Iuh<$@LP ;4Xpy@P ;w>OW[[.Z耥 szBM1j:[M1hW%!Ǘ_ Iv Dca@&ϻb`u%y?9wߜ[3MhQ0joᗖBtuarzѱv}a{\mdCı&ble- TiF$\f,s8 |\{^{QK5ڨֺTh@ITiYB#x\JP'Mjʫ$졑5{oN/|kBw ^1rClggE7BvF!g|{r{(zPCA[uFhn\7}8ޕKK|?C6(ٔM:Nq:}Vgju_TK}]{AebZ8qǴ4rZ'~3~Y+0 + V hb1 0\_@ tt>2eI81X#:A}B+((\oW3Hba9Ti U3͝Mz@K--w%Q(Fe =0YkTrH| l2/u6y5u 5ɷr0Ri*PP/PGV>>`+'xP22,z.MoLjuZU/GkIS9%ìNˈ洨Π-:l.!Na5!8,ő)7SUI14zayXA(hu``ipC8补x*k+(Ԛ ~?򻦈 _.&' LN Pr(1`b@18sa C12Vǘi #pJ PJ8J8ɼBCk¢ !^/S`_`Y~ifǯ$nCqpQA]wO`d!4:#&C[E+v  I| E(Eb0y~c9Q  &` Ds?ka2:8=OY ||F'mMN,-+d3Y:"ԯ9[Z -MNjX}=zU[ {ˆ5ߚnL6.,wŨ1+GfQ͆V1$s}Ȯ,;N-Uv/sۦ7 ~-^>ܥK\|noh}?.|X_]nяLetS"P5ګ }n,\[{ҋ\,_;:\Uҗ>D8VPUDLWd,+&BKl2m p;WcyFc":.ff Ff&XˉG u0]:@Ku>YLAUΆo*#Qu3騬jJ|=mev0peDrc@=(L8Er7N<,y+rgm@sc[hK(VMJS-G)S*U1Tuq-Գ4woe2Qz&knrrin]~G7Άzj<ޒd!9ЕӖgr󢹋rWr\+YnZٚc1]4.}G"z\ъgaV:ڀ8wѤVAWonjeTj"-ӫ%q:p}-q8Xd \غkgQ.7ɟĂ\*" I `Jm d3a:te{<bY!"-DB]4d!3DAdf 8عK:a^^;e\z|=_Mɝ1%ieZIxHe.K>*n࠴Z!%B 8y0ҦJ. 6n77 xw[e^'[ǻhb* nQb&CB`*C|)BV) !|wB'C7# "!d$%!<BTX.%! 1C !]2 Q"Q>VDTsP!P[k:pj7C_JR'p*>d$+p:RφqVp&Mb]\5+ʚLJ[d[8Bq6`\!Ѕ 4gCp  ŇV,?6Jt3{}kɮ&u-5'mR|mPjoIzDpL&>/Zerࡋ<)*1X-ֲr$70KhZӑ %_~+g0>F0f~8x^( lluD,:׆COs%'mtV)ڇP_艓.DzΤ8JVIљ4Nd&:f9 XN!̤]yxKZ%!2E%\1I<=s0PGWQ?} x[J,˿cMN!mu%~sBE'bC#]N)P G*H/ M`YY6`jwA D{VKi{AmǝtY:i'[FZzc {c^tٜ8z Vސ IN/l M8'E)5GFe !p "qnA&s}8uj|L͢Q=]Pp>RK:mJJ)n:xTr ]2(5=[jsZ&u]㍙ӝuc35QJmOڮrǞvGj[ m>{p|[&q& |E|m򡉺 <)nAumu((V8 X,:LutDsW$$Tw]!ẫQ5nXQQqɍ*HKnT{נUh ~'v(T6`m,EVdRTo%JQQ*y需&J X\,cbk5Pèw,Hbv‘bq'|Aou] }\j# E`{ۛ!o5 2S[c,NKjJ⁸q'Cy)2t?iA+-PFzbo@ s% '  B+#+ MrШfokLr=6o#Vř֤ӎe,)4CLY 7Är0˳hVߒhN9G7j|3ٵG< X#kWjI:_I| / %~[L61"w?QƭK4F4Ѧ94 1OMKWT W̓{:̺; YY;22ҩ[qQ';)&;0?rbaq?g @gCΐƘ>D! '0wWo#^6 sysʶ^ʓ>yw_ۤRO/Nu' ߸,=7n4`"@޺x2_E|tj]S9mYg^S]"Ѧ6f#)aoᩬ fOis(T\ m px% a!3TX:ZZZRTSjHI8Bh% ;2Eߓ0S k!V %e2,xKpX19xV!Iya |jǝ"bw<(Ik%ñBY <6Uu~ׯRgmkP)X;vώv7L~]cܝ7Ȋ;:+,+J0.5&utd0,[er쯜e,&uE)-Q nkzB Pmq 5![S^A⋋ƽ;w r6GS^qQѿ(dh{cOn=f+%i 92D9ec Kiu\b^/=C x&w;JH9Y5gҔRU>(͑M?9ouݛf%Ꮏ̭T#t'-.wLPH炛[ ܔ_lL|Qwm~x_s]P}㿖p底߳2iOf=0.vSL[&R+(=Nك$+ӝn0ee3 YBV _35kʫ*-XU9pYM^\դ0dx *)*DYsGH'N?LDzwxꐃ\&ЁJ:Bp㪓/F&+xMv<2Do2Xݹ8tޙH$>jiK\jmk-?ˉ>Lh?(-\_aiDn"Ko`;Y2[ u,e!Fֈ8q ͨ.L=ơihcp,jh KX@o,-E#iKH.VŽk6CW]2qŢߖr1PDJN+_ˉ_F~oؑ"{ϋJҊGbNČd H)ԧXY3rAW}Zbǫt iFn\lᆔ }D~҉ɖ_I)˺X䙠tX_@7~~q_M>wKx7wQ KUl?g¹>JzeF` (6(8#:uݞU5iZNi5P.!VT΂.si֯PJ,ŭC0Ce)7yb6QY? ̮(O=nC_lHp>,mYiOlvׅaiPTܲb*`1>l|])#}Q0tMh!m#isF8a;`1#?gjjd;hr-HdƳ'/aGnG 3Y>YmMy$:!H5IɾUR)aU/!l\E3xu;6Woș۠? &Ьo8Hgx&%(LnE6(6͟Pc0=u Oc{łītN3mg_:}R҅ú4_qаv/qiY i&-P`2w3fgV>-,b;G^fe]hW(shl-Vn Rɻ"XT<7@ UtԷfCqƃc'~vhZ4u`K~ޝnnKMiOv>8~+EK5ŽȺ2{3H .4X3X F]ǡ -Z,3c .pv`w;#`Uyc u8J+Jz+zM^+2y2&yuS2ГogCHnүmwąmMG635⍯A'976o[ L-[%Ŷ} iƉEp#r&)20lyC ;? !懋~.\fBW{a'\Ƭ-辥kQ}7=zί֒gy2%O+nQO{0Tigr?֋/=8U)Lݷ6o$e͗Q9$@mPNT5pJHtyBK׹n_d=7֑xs{9l`\8̳~<$,A\RM)m XkP|pUgXUKUL `fxos|i9y'gsFmc̅y%Q}6ZDt 0{--ɓ7)M^&hue=js׸i2NE%@4#h T<kݼڰYnf6^68r+Kr%3qwSF{od%_:ef]6`DQFc&N\(QnpF3uI7udSvo.4Njx7jb Ic'WBwZV0˪4={IEx"fMSBehYw;ƔY bW}{Yŝ_i:FKlЂA۳pUje[js6!fhNE1s޷4hhmz17:ݷۺO{.ot\l7bBB1ڧ:$Q2iseP^:pԂ+AY 0.R9ӝ/Y1 MJ0m vpyyY lww_5PEZM,?m;r0dzawB?Zݺh Vqu@I%ܛ~.FqCΚ(h< %~ C:lKݐVhyɫ')~6$g$^Ky0VYJ^1urGۭOu|~:9Z[7joYuU%WUe7JU3~]^c8mwfo UֺLDax,ps;+oe9U[Qƚ E¦Ao/lmE-pYzx3#@x@8JNWS2EE)6e* Mz.K,Kn0ŃN<;=cy.ȡfPiSrBPN(`GYZ1 BnA7JoAⅸtyy^kNW"ęcz|%R?& mۋ-{d!qX&c򧤃A؇1)%gndw{>=<_@ϋsW֪*TVJ VHZeRU6S"ttKGDQtn1+ i5 *caRU`>.3+Zj I]c+7ҁX8X=p'ͥQP⽽ߊP#-}퓧lbTJPX'I?NaPj6W4@ɟ䩝+{7e^AOf ߨ8ɻi*գUɫxd?mCՉ1vRAGl]$1פ*{meW.H6xROM)ݘog)Wad#$[ 3^tlk4DzVv'Vڱ_a !,;cb=TdE, Kc?~-&(oQwSa[~C-("^U|KyCխ3&/Ӫ?=ƕpO/óFvSi{̿\[_m=etU3[2_uRUAq.HlAgc33*!~0Rj+g)f|5fIy!7L~ + Ra%T*>|0*Ra Ysznjc/RSa N nIiN )HYb/2W*,'2(uJ6jRnKV˩$؏Ra-$~zf 7P0Xw-# |"vjcE|{k]cWmOkt#?9Ϗ s#cFn'.>m|ndarz7={nzjo]=6>k5T%kܼ^\,B&REO/z>90>ޢ">60{=\.GFxzad瞹Q㫟Nuna|810>?{̺@o,I"m_[73>6>?}7rh®qq< ;pkF<1Xqdn\m;Gi?㻱]HH=q~~dtt|f9"Zg.z:u̐}dLdY <&>!4AR.2'-ds 1JvQRZ258W*+Rc:҈Ւ GFLGY@Gm10mL۱61gwcn7vcuJb'T-bR[szjB]Rq$ARvV_nO]eA;I9)݋UL*)qAjmDs5RX5OcxGjFv=D#XnulO9k8'nf IC͐uhF_\]h") )p}H|};&eHsgbVGEr?[Tb{2"#!'%5NiR;I,-Y7c<̨Tnjٱ5sSi O|O%9} !eac>r ;o{{_/]rqzπ*WV Vn~+g*MW\ o6s0:ŝ;=?' 7NN՜z;)H'b>ʃ9!?HV\㹮?:vo>|tG]GGeFk^9z8kŵDz+߃>g]fkJ[=l땇^ Lah \CmpٷM"ZуW|`ŵu M z!C/ t/{i54@? u-lYe5uuz] W {4?JG'<]0,bdRjdžrB+,!st\H׋~a/9?)8:fKW-.utt+:y2u4!-8~k;#_j[n[ܲ$gn; p_]G̶Pwpf1\i __3K~ >yj<̓=R7Kf >{RRRX6/e,HY%$?H4/?i"k endstream endobj 255 0 obj 14898 endobj 256 0 obj <> endobj 257 0 obj <> stream x]M0 ؕ",H9CpRC;J=$zlfƏG=Ӹ4/i_Jkdy=>ndzaa.G{}Y~VUdMu>w˗sz> >cʿ║J?tt٦(Oʒ)s 1TТ0E[ ;aWKj_[pmi[)oy̕Yr#{ Ƽ_W`v`p%LwOJ'IRb??fGCMG 2OC7/_JMJ[ʹwr.8ӿ}mL εZԷwM LʣMg,T! `9]Y m endstream endobj 258 0 obj <> endobj 259 0 obj <> stream xZ tSǙs޶%6em dJ@-ۊBbY#m(IBi{l,MZIh6II nCݰٴdݶ6nMԾ^ɲCHNvtY ;?fƇTbPB&t Dqge! B8?7%<9﮾xdh#:?0:B!㢐Vr*l0CQ-)P$5+>_1 O-B G?G]$E4KnFZR7tK?&hjh#)'7lG>x .O9ĩ+DG0~C;y.GaFډE[^Gg{Ӝxx Irb3qcg<CIz=^Dg[F_x5zہҎ_ >No;O<^G/z @a\9)Жe1tm&-$;q zI^{wV\vrqtO5 :b`U>H6.zA,8Ej֡s7Q%hq4}L;+"_Cx`D<ܼ]Ύ*ۜh֊gPיtv~㌰ Н+/*[kv̸QiФ=qw#BsF ,B`kHCIZi_BNxdpib52_4QcZ*J-!M&_cwT.@ QTSp˱y8?L :haryrbb˷&&̿b%]՜Ws_-|u"bFkRXZ8n#ոL;.#KOl_.yKƥacʕ /xO[Cw}r&N 5#c0b!WG! ~Pw̠3"s~n҆ .8֭[om0ᰬ[W-eR 4S>rɧa[.?o_v<+vZJVrؔ2`苌cPoxk0BhZ6E]f'|qoLUrFBGOݩ):4w/1CN&TBy jRd,Wj0)(k. fT^Pxx8{xxAk0TzCr!9&A=6PLKB|Us^ēR˚rpρ# pɓG&cp=.acw@h)s.5}h-2,5GZ"5YrLJSw J[WSԳ:VjiAifۃR ' ~o_ƖwoUn/K.~GK+G:tȡC3}M_{ e}k%V4Z]4b-.JT9V 1/a–16Ws)ieXX/ܡIp93ɿ"sDZ-o巪5 ф/QNzrpڑ_p0o Bsȼ23\EÜÆy9fb*A:1>铯,N϶tBkVV[6bo-yeZ⧹ɶGb޳-yor)loz+ٴ[W4^9HP>RYQlB5%UђB,歴 s5TqlgCv@E5h]m V/X`  y?kLn_~_m[R˟y?|a.~7߸m߾MARg>a!Ez&YF\'olE`YK&"ŋM'mÆl'!67ȭy-ѱ wktpH7s CHg_^PnW18ғ(*\#$:HBehz:6|3| O6SMUWxI-beFNy /E"֌N(oU6A}%_U:dmsZ~y=^2|]mc$cjC:1MJ6omMmk2Q:TfTFԪsLw\Zr!IC)qERtԬ{Gp*JHMDբk`@R蕒Rb64J[KIџpTb0in4)Ǣ@p[D25骬5}(mCT|`" RuTJ512%4c")Ib4?Mb/*3H1>:aPQL%A)Oc}s ]R"N2:$%$՟GSR&%xXL611ÂXo GAJ"b8STHR4 1H*YP'@`D)O_x0^A9bw/5U2MR< $&½)0k  RM©Pl0Dª JPIĈĬfMlY2lT=àjT9`@T蘠P, }(`LLlbrwHIjP  @"@&!Rg"@!?+YvƢ 1KH4[Lĥ>?V=PX0HAAAf/' G#P.$]'9WqA0@9Lui]f8с1<+D*hi#IIq') X2*;=!-cwԜ (A5bo,QLNAֈxR; ~<1!J QDxPUfו2y6 2:/ &{`"t5K-PQJŦEOit7enm_K^Wo$:vFuww^qØmKYu>S_'[)vzOǷ&6y|g0u].Ӱx:vx: #QCggE>>ڨ`Wd$ՠ%[W[XunW;4wtSt4| ܊n`JCn]fwJ3]p{]m6 u7%`H1u:;ݛХECZL L3f~K:*]CSb?cPV-{^aQPܮJ8A FpuH!@T okh&PKȏ"jh|EJo g( ZV4~F)BKqaa} \>݌ TQo|(2I3Cz}zuc ^)[_ _i;P}5D$6i2QHhCC@K=?'q5%+{c}/k=csXEQd~Cu 0n3Ѩ9II 2>}lVHSh q"TT &t$HdzhdXlͦeKlqQ0b1b9RlRvahmG?Ӿ$vVwDYwXEuou9Ex&SsnƢ!GCIHgCQB)Kb= {S$vEShx@i 8jeO]1Vf|]fxo%;GJ͆,t ]׉fLNǚRg1{ԏXg_zR[K1afhTZESi0Q޿Ag_,4ZRY5ϢGݴ$?Цa~kip}Mf˛˵t~`ש IL,d&2y3wz'*֗]c_,=wOeYѦNۜ}},KA5Ҟ k &asT8|]*YEgLUzźkp:;Ȩf#|-T,}Qs6EՒt֥3 2gb68=W=|bUj}/T r39zTN'|h'lc"0z0b3te6hSh “# uLu3J/mvttEl>m7#zUu*h0iڡ- x{?!E=TM] #ʙlXnwu3<]fEfC+')E3cZPI>,4Tj+U4TL3\U,=([3m>1߸o:vLmaLB=(R<2,40ߨL!}MKf{Zёs3u7zOfDGAVĽmY60g7TS.l+ Xx>0~݆;Ym,݌|ݝAoKqfΣ4݇ ldԦj؝A* ZwR={>=ΜJϟZ}Pp3̡U곲gypڹҷdL?sM>ڭ܍OAvNW΂̩D?bӕ`QdLb٠b./|g*-y 4Cͽ!~Hbz2 t|ߜ[qbέ|O0;U!Lϓ*Jf0(݊LQns(Š?Kq/eT5;{L ;USxf(y`;x,wzI&ΑΑ篒o\%=,-erL2 ~39W"qL2]½Ƚ{>U!ܳ?UA+O{>+#AwAiɝVr$wQ8 `a!I*#$sHj!!۪IfID#焨L"99+]dCvCg9vNW I?$L2 ȤW&G&O;ervEddl(̤He6.3IG{P#A&V 7\%WI~n J+lrr\FlQؐK>n$֏u3 uǜ| B]Ԯ-j[5b8V Y ӫIY$4{1ReU,ty۪Ϗ\BP>gqx ^_fn endstream endobj 260 0 obj 7234 endobj 261 0 obj <> endobj 262 0 obj <> stream x]n0 E|EbyJiE*0F*! ؞R{NZW?3\Md.QѮ%iv`l0e"z:}x ؋wW`DT0{z܏k6aYE˟}q r%& ^ )eT X/'l9Q*4˶*rN[#|G^37yKg;5;qA#fN 6̘+/$}Cl觵B]mAR?E̯D endstream endobj 263 0 obj <> endobj 264 0 obj <> stream xzkX׵{f6Fm Il/Mrqb76Z8 NmzM۴I|kc'ܞ$f$#s;̬kk M " [Enq 2ޚm)I-;VBJI:9uA("(#מ@oPcRZ QA^O(o19ONAI(s'{?DHfu BySɫ~Yi p~¥P" E3LPbbլFKH'%RRӌyy͸M]?JןKBy^GϢ-E)t&7Џs:AG9s= ?&I^ڄ0|(Aз^\ZϢ7݉!ᡯ`x?zm+|D@?I-'OQ.tF#&={&a h&^j-:hf/#_@Ch$EP/jV%0KQzY^i+y$77~S饑.t|(b\d=R-vosoAh07yhAP P8ȃ\ \Vi%3pW>b$Hݠ޹9s˳f5-Ts.0vAW#a7+u5Z{$͍Tn0iWh_U@Щ$ "m튔94`8x;L|Bŕ]P3Rgk6w̦ͅ:>? 0ؿL9uHŒnl"4cB_#+rf`#q]pya5b0GmZ(A L4'U{ bFۻ&f0 F[m.39#"̭]}B1gxюQS NhCa6uLa m v Zs3=ICGWs<*HB`Ggnac2D؀˅e2n d0W3,͔͂E\6j#sQ:|SFp 7P> r TsюLPgʄH8lDK\9h6pa%MP2DGmqSe W 2nFjsKuJ57'37 Q$o #rA|60aFyn煹<"L9sS`U-RC۰KKqsG}^.3>غ=] vt%42/bB 6(Dz9Ybyp#'[a4H"8vGGGp.~t =2|%F\ 1.`"Q`}Xi%^ p^9eT'. Y/`d>+S-HR@@ hF@JR?>]cd4&'2K#L?*$&e#zA oͩd3}*j0_!l/_FBYe2g:$8gԃp\N޳G6/#ddX|99tl?˽r"3qaW^VT`[ߕ컢VPdRXnpKYei瓬|؋H42]gЦ֚t'9+wK}jINWpwOuΏT.~/.Ppw51Y%ߡ۲״SņBNk̩h {z^%᫤"#"E!V(byB,W֯ff'qy%1%GZضM]S$n4d-, LqĵlrZŒRϷ'A+ :A>T lN"cvn+oӌN >8{[y;\뼻Q=@VT֕~N46)ٔc*RpR[n1A2u*AbA`{Wto| (57e|]ڶ1wގ,Z[XAL­R#@~.ȼ dVsd#KKIމaj 'ɺeDARJ&QJ0ӔA "[dЭYNr6 kfP<$@%iJ)I嬒R*c*hL5=Ax VށKNvgKmǩjY'UC6VqArJq=oqSlw,1{DƙT'E$TEfZnfQ<"(9Lp<$;vq"#jc+aGX' 怰go<%Nq2QTjX%k$x p:t:G#@!Ϛ%tL|L(ZjM Is#,d&FNe`"bq}=K˅m|˫Ү`5UD\/.LB^ʫj@ !.ĤH~ia- CVt20,Mk׌23LT#@ #`,3Ch4*Q\R,+ a>PYĭ:C^1yY^R\UY!Ya,MHӮ*1 %EBfgeх*b,)S>-붭-[[z -}yʾXExI5yyM6ϱ_=/Rش{' ::@Ρw_=|<Ɠ^A(&۲&mh6ocѬ(*IA1l $c1䝘K11%oRz6%Hv"i!sYD%۶mT!RW'nq(NCT+g*?#D$&-h[MGqUz=az+ɚR/`k*JHӂ tFfұ;}c: `wYzYZϰ,c)LnW75z17]7fڋԊA75~yjkǯ[׏u-yъ oI;#._Dǥ~r kw~j ;k;ͅq|[ X3P $cCG52#'#F"ah1Nw gCV\mҀ5 YE İC`{M ^ƨܣ4RɰœEpk߶-mqR-uP2Cn:~Q03K4d[eiNjnMocUo];O-˦ꦬ? ζs6srS@m:˟b7q3 IK؈L=d0 .L^2jaeEn6=4B?)`E۩ؤ#ΗKRF≫Ow@͡$2K75+E9^\(U Taw*يV"$X[[b! bo ^֞q#,$޴ Vʽ &0 Y],Fe!(qc(5hgxY`cC"#do dkj=U}jd}dΦ$~u纋12uVȩu~vwLT?O~[̕rڢ;%-xO[H o+$e8'+d0#MYYȣ+M ̓>$$9Ѧc\lβ(E ӗؘ_Vuө UR\z%rBUOn:1^{JŰfR "db@dΙ0qbz:xIڨK _Ko*)H ~v]5mސ|ʝk+<;{t Ϙ0jnXsw.5{pOo ^*F~^TaةfsydpI f:qn&SUFqq$MNcP+~ci22ZJJB&,'g (=aj$Lr7j~);iM$}åoH.7=YԊ?-vÅyܵ,aWboZї޼y0PHU 3}Kvqsug28|<4 =ֈqz7ɘ5x28 ,}WZVZ&fQ[.MPKKA/$Gk$쵣uNMjJU5!^%U)ysRJrerZ}CI2N:S]ئlNf >ys±ɩ;aLp7Tp݉# u#X\xB&gRQU1RʍhLC 1# h<4* ^j?Q',y H h׈M/K/r ~dvB('3 "=/ZWצ"p`K3* (ѫWC`6iXkV23f% D9*l~r㚶uujOKv߳fi4V9RZ~Q))5 ?Gx 4% ` BORt2?kQ=!r3|[^3}Z);P(5T< BdαTG;Do4iFyE@,BJGW˗֣g4ZUfAԣ2PO< Bm5"-zg'ܱ!+д..\2%H4 NTBvme}\YܒJpo{T~u_/VX 4sCQĵo-_y`ȉZ G/sWsP ?CG'51n'R]ԯ"$#cdKH!Y,$\~ ~CcRU?JƁFd "AʣkqUMc QB(i9BFa EDa)څ^2 bWV __(JRi9Γ(QEEab)SP1e4 Fa{PߌR(,C3QXRGa%*DaɌ1hY6J4LL qpEe\[0y\i|0۲tpj{0ϭkwu4lF9?[SۯNCT`p<[n)n NM pa~A[@Pp \g~{>!?:V E`p*H9635:z_abjr""C{(=ȭBPhf۱cG?J<[m_W9 Ga#[:xB#0F<4OO vgƂ!.4An cHgDwp;'f8`p2ȿs e()j@hDSh xL,Ԇ(oCm.@MhK>@uh ZO .(AzMmЦ$O~C@ ?75lP^|O '𫃞3.1tyT_k75ӫB~iE.!wrT "Wl)h $6.Ru|I-urPr#Q]D bMC_ԼsSu7]nzHK!f΃Q"(B0#&E=E m"ϭUGEĎ_n!-h~ZlIV? :ME '|-Q{G{LBkn+6A;DyX&Nh3(5inQ$a %S57gwsK?~>6_=|v?y^|?r~Dr/?1ˇiۨN0\el/u_vq_*4Ubn6/Jۚroo g O',9F=] w(Omw}.$th*\8 L#5XkF֕ lhuF|ZņXl`= 4Y4^BZbThŞ>iZ 4dZ p endstream endobj 265 0 obj 8784 endobj 266 0 obj <> endobj 267 0 obj <> stream x]Mn0Ft!@#!ET#g9̏ȏ\#;3k({"OgkfsKcdrdߒGޟӼdzKO(?; J)c{]wk]Qˣ{hf)z$ endstream endobj 268 0 obj <> endobj 269 0 obj <> stream x{ xT9{gdf7 aDVLVd# " H2if"E|M BuV(4 RV{'}<_s.=yM75m@9띍)W~%HShQӸNjJ@䲺55w~!7t$XMڠC()#j7ZAUv^<~su x,B_ipֻ+^!BnB7'#1 c%Y7M Kf OPG5zMcSǥgs?={ "GBįmYh?z }< Z]0whJ>F9z s(ܶ H!]; ׵ =kA.T30]6l>z@WCEϢSEU>­B Нnn C>a#P c`BKO ) ۣ9<^(EoAGÛdqZDtNEd*5YVKtx.%_@?4-FiB*JïUu~b!Ɇ'kb3G2yEk8i'i %܊5xh{ |4 dIf4tO:P(ND"`X )EC$KU:*?Fb{)q+8 _c[$+C` 3&RkS[SǁkiX+=KC"cC`IQzٞzlOF-іhKQ,_|$aD@h B&fi 6uwĜ:in-z'38_pJmʔ 9q#dlIj eK[6o޶m-BK#go޹s۷rm8OWk\.:W8:I(4ڢtDn!"Y(d:ef )Ŗl gemV!9i$qUgIp__n|l޲%Z9^/Wga5Q#m|#")6aY*F: =@ Q'g%C~ 6zz'tvKz[[IwYG03wXÄ[=1g 0;dag'3⥗ݻi͛wؼy+9#gg<| OLGMo>aOc$ 'ظðS? |TKHWPGbpڭn6)1Wz.X/e(zbRh ti~t='o_w雟woUs'Oرx f+9ctr)U&~ r;"->A6|BĨ7 7VeԞ+5|[\;O?}~LO]",iŷs#2`? 5;AfbH1">!>7.>hO|\ v<&t:FM 1:T#[trhRhn ,xcW/[^GL H:[.HaBp< AQ1t! 32ke*׭73}˞랫?|兏SNK]9kf%zϺG&'wMP`xkO&r|F9HG)rD"2@k*6}UŵGK߾ୋ?5}۾'?u0L Mh jpdԡhCG"u-ʱ] )FY9_n pelS0G\FB>Ogg/b_侨}іE?7N0I#[uQNP> ]w=~[~~=<~{;N:Rn|1}u-~~qxsQF R Ar|ˆ 2ȦPYbOnflSZcY;:;?‘‘{-ǗTW) / ;;[ю-b"!v3 !2{wE\FJ C%QƐSfp g.-ڵ}rC9S =Mơ|S9S?|[ncz¾Q\h ($h B[٭pȀd Xr!AbhѝYNجA:^d)alҙWXևΪ׾I'1^+ަGFZFOي ",8ˀ´Iix~iI\ĵSKKw->@긏 @MP؎}tW%,a`\H x8zn9P@ԩcsy^;c/n&.)җ蹄D|~zcZי]1GA}9W*umP]7* Oڶ5־Ry_"SH 8au|PoԼʝpRR}a@X trN i$c`l(Q1%ľ"0[L##Hann뚅tHy$#"y^ke=,DV%yT_ QIܗYkNJ}3'(0$a0*$$I#tz!JzN H#9( DOdt¤7z1Pap!"eF9ZLєpMb()c6%G"0N))DiRud4Zw E$MM$E =Gkt,~l,'c- !!,%g¾B!w#oԅbPȈе%0CKH *dQrb=Eiz+쏙ddDMI/6IdU>quA>5ZJ*z bժkRuԹKٷ{^[`}@XlQN!"RDBFİvCh{V( 21cThj7gfCWV2PJ0( v>VxgPM‚UP sdm}װ߿CZ'I .mZ:Ck Ǩ(s|( 7ćO>qӨ($v{⌛BX;owESĐPaUz ' lro[:/\h}ynM}ҥNa:}w76HZCuwށbsޯzHB?uDuatŜ-X_"JKc#K Wf2W:d}3(N)}4vXfrL3 9C0d3LّQ1ٱqqAޠ۠```j ohljnimkOƋF ëG$-'ES{,:M.(8C?[%lķ}녍6dɴBU ׋a56: xs{d[|Lj9$'&^g/g8LG8]H'b.tc)el!dRg٦2T˄2ci1Z M{^WK{^^^^^AtA|PwPpxt DŽcxL:&333~2(X\,-ob44g-!ۮN˦Ly;ݱ޿__"\T^>iriu'I8c]M7x+]K?G=)%'"=s8"1_q=C껝S͐km:"qvQf)3h By.Q7^'(D3p륖Iױ@Rz6oGյT 27oBO8fau&Pv4FLF u"$h-H/] ;mg}دt|NW=xNaf*l\(5!v;wsz_c(qI_:4[!DAVw 3gB^ MV߇Բȓ+g?'Ǐš/?tW. 1ːu>E7ORR LȄS2嚠 ͠$$"[fk "_w$HiMH#MM5*`}ORa@?|3w \CHWs} Y}M}H\G"A\DLv l6x(GXgyf}P˪Af2%|@/K}[޿z{]st#)DF?0kmOcے:RBd Q ),8uٛK6MٞI%iPq׮lr>ޒ4?oEm>ȳS=2 '( l_@S/B} H{y$|#YnLh.^=ڑF%X”QVߺd`)a3+z|$0m> <:cJOkAԌw }ux??fGX;)@1@<=I2@%,Fe@0 9@|i9`7"p$G'#c 2Q?` HX&B@=pjkzcQﰚ⫏s rCYo7n t&4n=8Bp'~&i;J+ko?Q=IKn=WH^;˥T5/VA:,Ўx*GS%={mzfF5]qбҹIcU; NCD4Gtԯ!L3/gDb 4 t-/;'q6}sOuwDф1cpnd1cN-58Xؓ Ģَ1(6R[dT4a-j{,=MDlHPw?_EÕW#>\~e1M KP} af8rp׆_l\=lZ|pmw77?/LVn+,IEl;B |ԡ;ވ$dMgvkuS /nLAL办uWl}T:fz5^C?U2ڿpJ jRgq ڪoiĒa2gnw=EVU 5 zW19>gv| 1H4Qr{v;TȈ4)>lD|!>,&'&d=~@P߇X/P*I fa02w?B]n޺A?{golK %ܵa5S۷wl{*Ϝ9|ᣗwmبD3 5"_AgL*[-M"fuœfʓ~W3..z^ y&S_&"C2&ʺ08}kvWt#^釄-siWQYc 0 dHH?t4n_aY3mC]0Z$bk߇6C$.nC`~wgi3ԫ; 5J Zsh:P=oo[&ѳ2 T]%^Z(ϧr.Tפ{[?Mpqßrl11wAwzےko[~-2jlE ioQ±X`\jm>-B{֖`oڥedA{r/ rB2Bim h^qH1-қ6hm[ǵ6DE-XӇZ[LZۄvPH|mA wy4yč,e%T:MɩS*OpM+ݮ4c{snR]lX)&iPyiT:|J>6?x̴L{4AZqjz W6Mo2wZ_ɘZ̴~>[Y FA9r8[90PQ79]zg [3Xn8@]nreMە40 RWq6Qs]= @J5((n qguH!I\V{ nw7~O08 Jƿ 0O5ir76y]ng*nn56uT&3ۤD3m#گA}sCMsSt.*~6b\! 6<T 9zWjq7QƁP)Z'ԭj@;mhRM4k (MUjzƿxX9zN[B֗ js6qA.ϳnMcMb&>6#o$5\*`κA 1t*6ԭQUcUTPɘT̀nNnQqQՂT,9JyNEUQޜ |NEyYeE Fye *ϨJIU0TUTJe 'I-R0MS\UUVU0ZҲќR%L-.PuSsJRBfl҂T 5Ǣ*N \ݼʂs`"!3 0 q͸`.SUVQկʼʂT%PXQ2 f9Tӗ}=: /)LBtv7Ylk[M<3G 7UxVy 7ؖ_> a7RӯkX^LVy||6X=~*ȗ:Ws lMd8as7i[p 7}SyV֤mϸ&(59|Wq.04Z* Ort-Q<Ԅ PT ͅNz>^S&Xn̳5B~o*2~%ЧM`m7)-Vk_{QsU5{xTTkHxCc TW5qj1X QYϹ>5Ъxt:ga-q$`F)\m\?ϟd|Tm-Uf͜*|5d`Dm30uwX3٩`Gj<(T աvȩ6GX XQ/I34 ݃$HwrTq\eɀlأi:*m8zyf\43/j nS5 5;ş^(} +|rj A2L_W@Fc2L]|>8 \|^"הaˀYS5 ʡN=jd 6 q!>߮Pyq<Ϸd&-~CF|X7wC<[n/&=|IM];|{ڬ'VS smE7GŜ%nCsH+HsJGx,iت<ոWcxyF @P+B@vـK5GQbᾮGM9",9Z|k6: +C=ԃ<5 +nj*}wy{=zJןrJ@9m0Q5?{gp w+pJVk7P}[= ~]NWkA_Ud:zN1rU˚yW Lh~5{U*k Yew ;7 ;U}|MߍڙfdƷ g0Է[ü>}T4e,K49+ut/W06T}u7Zn~`P"p=vڑ6޶k0 W ot)'u3P&\S:ޖ9"'|D#رJI:Kɗ\$"}NkWHZȵ +# Uxe$g?Q)%$C'mT졤3ĿM'.Km䢋#}L_bȟ)|DɟFI篓m䏔O @{a6a;$FZGޜJATr7~oޠFr)9&%N^6ʎJ^uEJ^w$uSrw4Ezny!M!RLl͑~CN~ W.rE~i! %OQG%ORs;9@['2أ6Q#㤟##?d?%?d(iUE~l%?2=< Bdwx(M4HۃG6Jz(yp})q%?~ܗBZr/X{o(i"-0";)dld+%[(gM6l\d#%VwSr:.|r%(YII,5N~3}vsM|FJ 4ԏ*IhRGɊLO&N%5)qQR4^d)JK㉓%,΅&N Y"wHnd@D%(Kɜ(iN& Jf#唔RJJ8dh2(R9٥H2 RAtMwB%$'\g'yass\r)'tsd%8:e Rdwb%Fɭ­4JnMR2"GKgIL*Md,rsFt,,J20x|4Ɉ&J$ip)(" %:&6jRCH*SM{S42F*d4%(LRs2"$S,%QeIEAr<%qĀWbH4%QDR" Ix8)> endobj 272 0 obj <> stream x]ˎ0E /{ď$"H,桡BbHǷnfFخrr=aq~V!{:2mT?tNYr쯇p,ns|M?,{pQOǴ>ާ_}U59󵝾WKOxN)WF֚*v>uQ4j7gnŔӹhc )(j$6l#;pI. ~^q__aJ[xG7^1+0=wjS7j;%+>ܳK/nr?L5п}[ߢ}6?;2/%V /@5w,Sl$ŸV=4`dn1C4NȒo5۩ endstream endobj 273 0 obj <> endobj 274 0 obj <> stream x{k`SǕueɶdCd˖]d"˿$;ž%B*G06)Zn NȋJٞJuHAb0ـ~R>-%_UP_!%G>K <#wji7\زh}]v\SdU WVKKޢ‚|OەiMFj*(@'#% {|'+ayO/)IHX'!(h͘2bނ)'1`%#%ިHgams;y:^|1`F >sNJ@TC~D]Е)P=jP_x5 {:QhH=uJ(,HBt*p~ꡳfǯٞzv:ŞD=ogbO]}ϸ6\oF i\yTa`;5Hѩ޳3=3uJG x;RAG"PG3 S4&қ׵'hATx nK,NUTuv<+IL6'Y8M䠿#A{Xٚ6V39[sǃٸ}*4{Q{ў6nTE v(J?,%BT R%@Ka$Sf%c0y -iR0>oP&2J?9 75FʂHۃC4\ _"MX=ǓU?]!I%KQ%ue~.)ing.'9^y!"hWS Wgڠp'O@34PelέU R$+;6vG \BSک@D3HQW.|`iwڋ&YCYԁ˹u^+gdvyzLkYyNyv Xd#-1LsR=--'Z?ߡ׳!F`0c:&.Ï }ZUtmt0Da8(vnI:8/Uy^k^-E \v-oGx.pP 5uQy9y~Z'$ߚ'P7Gf @Rx2`,y8I||" T̥OR&@O(=@V7#PH{QtcU֝ XWg[Ӎi,Q{~ۜ8s>Ay0-`p0_|7 )1K83ȠdեNEejnC׿ /0rJm5xR(*,R2lڦf( wYٶگ}YeFh< wÉHxUDxc \6/)x9w&w.A=ž[zٹ~}ć^ٰ Îb@.7肧hjk ;$LEh"(Α9MkXK2֚d哲jq$/|rn8Yx< zG^y^1ςnCnzZO++5+8\]Q#* Ltu C!~vP.@mo¡zO^)-**i=H0ÚKájcQ1r''@sL~m~eJ+l)oke@G܇~ ƣ{_l}V`ӱ8ڗU/p7'ˇ˦yvҮb5''㡿)MSVu}Ѐ>وe'c*a#'i0&4,=:.j0͘ GnuL&}V3oBנ‚+7Y-<*12zʒU2}`uMR {ϿR2ڭ'w.ڢ[zb'oL{#Y+N~9eF/^Jl 4-,%K(_Ηs:~uТkVQObxN ^Ur;G|sŤ7DGe; Њj=ثP IKWoEY7/Ʋ~s`N:Tt&6E=h~B^aU8f`ig7ΌJuݦPԷ$QhZB7_5;=/otTV7W]֡.W3!b|ZM~I+ݹ9tWg~to ;p&/WmMwn >8wS/Nj/jq-5i jkOjig*@-FSEUIgU@Pi.jZ83N9mc7 M+i!=́+Lʟ =G"w̿ϠEd ,ڟE7@iU'O:.q9 -yv\ysyBr='Wh 1i'yA3G fa֑s5mT{漼OI2`aaǎ`LgULlp1;Nϋ:!um,h^bw)&PrbC]pb>a,]aØ_Ar/?)Q6Uв1R*+P ͘!phgB@k #F`udG)aDGD"D#5F-FjX,13/N 2SM 1, ׇ[HA9DTy%2$~?l*fWlP#Z|uՆ/|YmJ\yy碝1Ju ݧoBXƦpמV5FBj5y׶PkѩƯ|${p. aGvLx`9?觾L(UDV+љP eT|R1G"EeؘaUiaV- ^TQcWB,è :\αM=a1oVڍGqiN)dȦ X>tt [{OmTZqJk\P7nsV9LNXIՖ/ |7^b֔c͹czf~7EY_h]ؿW `Z+@t;~7ٔCyj P̕c Nh=-Ft'u458lt!9_=>_, ͸Y|Eo9gQp5eRBjhWS XwSG:ﮑ7-Yb/my`V%=*:Ņw-%m[%-m_v-1sIo}VSԜxϝVl ioho%ho2YE˝|< 9iܦe\*'M7VTBKej48hQy#m2Z j#phYY.2?) ң\Vc<߬b‚BVdz2qv%%#1e:%wJ\[l6WMFox%\ cbxs{KMfA/TYӲ9]E*zM/fq鏇+GlMp@|MO)\[\Uً].[j@Q,z7}?6=ݹ )W+t|nۢd6Wq.ɸ|~I7tG-{1n amNDьI-FqZ.4M:mFr4R- |ۘyL:uXSj:-ϻ6َL5cks՞h"mquzݢ(kD5 ץ9„oZ`WAtLQI,/d_H6dgWTVТeYcW<kRubgbh*^o>7nz$% >tjx,f;*60rasDŢm_ W~ l>ַbs};sg/gcz Al3gs]KSiIXh*dA~~) p?l1oNg5bEٔ{1᠅k/h&L`>/zbr-o$N$d0 EĔ4PH ,[w&[d~r&jv{ܡƐ_ f0 Ae+<Zk햷ݹԼ*/f8rsU *jmjwm]8JèIK8dR,yaZZhSD?my l +F$ RtYzO%$jfi.g-g9P&5k[*ZJ:8\n p*xg F+?l̚ Z[}[𖊎])~ n=mj-y|d˲J=<\pCIp~/hМפ&[n>{4H.8RRP}~Ňu%_Yj6`;"7JE+魬.٫uYQ/_UZIEZG0yO/ԺjYfYnVZ=N~-2BCkeqtғs&j13.Alhj+U͸~(Tʈ *PuGefYb8Y$[*5AX _>ُFWKl=;S[v[5?^{i=U)[RԻ7sx~6*7ؒ#pQMp\8)fR͉r{Lv#+v= հdB~>#f ѩN_^hR@[rd13{:aQe siA%\kΫ9o漝簅玂Xe75|3& \Y`B-*:V9%9 ^'p89F5'jCiٜ8OE˽#mFъQW/na-fk=`mj[mL^kzJ~Q/QT|>}ØU>c3G{|̊ƘWj3&6LޢۦR+՜&k1hvq& <4;|0胨CgJU>x}^y~bT xBa1YPCc{[>,ȧi>}p ^j}P|?җ#5yw=DYVdE|h,rߚFEJ5\Txu 6,>إH#>tg=׫oϽ3{!PUU2Kƀ 0%zCʕы=^Q,'Ijx7|3 HK3{ӯ](&!Bw{LoZWz@akn%U|On|r%\p⧊8Tyhg!ćؒO..@F2A}ZUqdTMB6YGգ:FH򌼼-qoƽI~>6 A8'BTv;wV~UQz 5ݪC*KG$e05 < "Fɸ NJWy+ C {_en-]<Ӈ`6Z'y1!(;aH@ƛ`9qkcoE 9z&Do rP͐vnw%wx6M$|[]34&d#J:I#F8aqvΡʊLbt cٙA/1v㍴;3ػٛlq[pp9׾8>ǃ\?ɽ&ӝ6-'眩^zJ4RD%D]=D'z黤>;S%9z*2 &5q؝E菱xZQ0cTZP[߲i4<.Jc[z6I#7/^?0;110[URwb`Ի_jN4887 M"qxpkmz"#c#)&v H+z'&GML. rl bK&ln`> ?>28qW&P?[ww I;GK}}8)a7_'R$E7BFN2F2D&D"eP @'B d+#-%+͡Wrxa.GZRܖhJ,V{1M v/kEx?r_j+֮Vۀe(0.|bnUZCE?E/ῂZUPhN[q٠pPx'1mJ+LWJk[۴؄-*Sx$9 Jk,ݟ##G.t7q}Б#g]DG0t>~s9; '%.|QWtay8>eEFKT*lqM./lvvq/\ c 6Lha *mŔ mY6ukS!l-$ԸT X @$мP^΂F./Eֆ\wF]PkJkpx6HoF򅖒yQ[PWg\ *7x ,F5+]yQ튬4}/Vfſ_Ks˿6F+Yd.EFdl6 !S\.S۴xSd12]2͘5XvčgSƳꙖƄ:.$ Vܼ6z A֮k?~4&B=9~dL"`9e#I~+ qVJ%cqh'Kq &+g~o¬tO8rŦJ+~KR(]X)(Ҏg#{ endstream endobj 275 0 obj 12596 endobj 276 0 obj <> endobj 277 0 obj <> stream x]n0E|" !%$H,Pi?" YVtgyy.Mvl*XDכ> endobj 279 0 obj <> stream x< x\e̙?MHҴP2Mj*E$t$f&}fNfڙ;I#P>FdQYTeUu]WQXוU=#Ao7?ssO f:lK<[=?d0E9/Gk%ɮcsvh<3֯WoMijk.bLi.+ [qTA8|yFmuYu nίƹȩYP!nco>Xur?_ɧ}5#Q"橣{/{ힻq7ʝVĕ/y݀kw#y{16 WeROeu>~;.c=>ó >PK+ vCf`<51=TH ]ztv*oWc1Gyg[ÎA[ϒ_Y+c3=N鰷=8]nϙe090%?>wrah_~~ m>}d8?>kpOEwPp׃}'VOhaOn&{%_R 2-+|gu,WX}ꕬѧ}jk&} 8￟f5W6e+V49g7z^ySUu̳\}{W:t{c7ٗd9?rT9\b+,k 9(Ix6N{D sgMow5~˸x%?}8+HθqH{5cz'qCˇQ0b!%¸֑~Ф^Hmdض2NiIkm u2KiM^XFYx())@ZJ'ޝ\a*'l gdT٤Tc̫}8 qӹts*RE-Lm pLDHPb$ @m~3 cE_w>Q`(kѾs b4P0* #[q b?F\DH  "bd42G GJp(B Hh`k̏bH/8l DF#@:K!; ŢH00$avCA BaDQ=A7w0P`@`8eupy` 8": 1 u$v{p. ?߹5H$P%HaW≅#+;CѠ_"H$J{FQxFrmw < "¨dx,zWp\˛ҷS#Q;wk$.|G,TT^И.*x~u,ڹLKw1ȧN9cLgy6 ,YLu,wۈ&!`=c2 Lc*2?X;p`|p4[3@HKTcHii~%*91}8ڋv"BV%lPI"XrG1ěF8u\ح84NTMY ]CNز%&r:I8߁p:~PHġ l\[̷ܓ>jIg+qzt,1 ¤dķI( ̕C*ZHO-m8|ol)<|Ir㲶2qȤeY>\Ƌle [S4Gqswn[˦f~K'|މ0XMҎ4wp\CABۼ۾QھV%md9y6A3#(f I;~88c+~II 8vI&kP;GΊ$@h&Kk2H:WXGdOּ"xڿAaƝvZmťv5gs/yI|,$#$ n4$)k 4-5!φq'8d6Bq 1;16Ee 97h0`X)k2T$JsվfkþKE-'g黜?b n"ysDUZɔsԥΓc ibs*uy׹7J7brFf$Q8Uhc^)9T%}ץ1W?Ƴr A5ś߱wΥdYJb<ҍ9p)MT :V>l+==m2;f/czE'\?t il?9DrR)jvyvWxHIQm8TZ1D:q~o`v{IFi+jZ iY 糷Bge;uX X Tl-H?h9`pjq-%wظ\#t8aCEڹ+ZsRޮ+r5ZYw+rme%`g΁+oKU~שjaov-V;Qe՛ܮRUS*I-ywWI*-.*JIͨͅo(>0OMeƦSH\Ӝa3 \YjU/λT4,oeeH }Obfs R'Hל=:ISr{\te_H ^[y=w ^$p?/T]+x*:\ȥuPkuXWJJ}rīn篯kJf_,љ+Egىt:Jx+-t.]J]⬺TqfK| L|l~5sLesLw3eegO$.'@ۈ[[?s#^Ww{@}@h1mͬ (;>$:>]vr^Yp::4<[Xu¿$N-AUSկy\7g,kj xr̶?gFFx~yS@fo~jtOD'g |" ?qYq' }[Y F]FpD;g,C+;, spۭMm­MAX4g}mT޷:  n>xrQ:w+[|nwYwt(pySn|{rc+n6@3ՂҬ\o[\gl9~rpuRj7Y0eF\`Ba8 y t rd> 6({ 5 8IZY nj7왅?^WZz ^g]\= 8\} vX0G{ &%zDZm++,CMʰCM0hvnPm%4(&@p,nPzg( Ȃ׾Eym+״5(o9~6\\j/iU^= lnR.i+zx^YtYzYllzp\vb}vX^ޮ eΆzxZv6E9׶HKfiQ[p,ɹ^dj<\XeA+-hA QhhAÊJ+zj7Y,G,kpӇ p,ܻ> endobj 282 0 obj <> stream x]AO 96&f&=?´؁L)VM<@x7kQ13.qe0H|pPewMJ oKƹ16ү-78=8Y;{@ޯ~Mg j[8=O6=u.;"_mKd USU-4[? }Xd-ISSNc2K2{?'ŴSe}~my endstream endobj 283 0 obj <> endobj 284 0 obj <> stream xz}|Sו=IO$CzYm66燑m _Ćږllc$4$!& LBkH6iA,LݦצaL?BKgv8a24 Asd>Ҵz{瞯{ϹS3qdBAdϚBGa𞄸ج_B8G&* C#ly_c^Gco-@ F5u!/]/sQ޲sb8:]+ohc}xtWÙwVNNL'bpJퟜOnS0 j:No0j'BҬA4>oWP.}/~p3qRp1utB?CVFch0^FXzV#l_Ag?MA.Bz,a -^~2>}~ ;1cDGn=K 24=Ox&:s9/huڀ֢x?9USb"rqhw5V Kiot Cm-uk&yMU +jWT++Kr;n-,A!H1YIER(TAR[ibD%oTrsJRAy5V-|+(g֎^>1w0[6%g4(&qDlIk)a.n(G F%KSD*@JZV"ˢ&oK4 w]O_EY ]h2]ԩ,1*::(*{,">SLEԛd0vi{8i%K`9yʵ<7IĹ!PGZvL4z! yZ%u.2=8;$4wdl p/:w]G|d(ٞ:&U>M-фX7C9UY A#9ћnhu)~__DhR.]sIֻ>&FCOwQWH|#٬bOA11)[@!s0~-`"Ml "D2=9@(O|iw& J4㣖SU~Ƃ~i2io2ի K%Qd83*o ҙŖH0-%uCKjD׫Tع⪨e76tG\1Xi#b˓T}RoXLQgLuݽ]R{ ʎ|JKr^N%.y@H͍L<\Pmn{ -QR%mL54օii <}UQN[L #8jRㅝpب(jbQ1{n<3PmUm[fB^jPc&[}[lS7u_8k22 H>h+VzZaEyе6'u6԰纇eC6S>qJ㡤:{`.wzω+T,X 6(Nhp*뜂Ь˪=|#-0>K8~ GǦqx)gl wJ\8rEX:| )iILMߔk)^9E]NQ1MT:Ty #i-Tjk<)5}ZxS|z=VOB|,5 hlb5!"rFE U+F g,o \-4 . D+pY  )H/Fg7sD a@T V4 AIaV`&0/\XNc$fguGtDgbPQ4g,^o4sV !-6&TebL,~ԟ݀W_5Sk>v۝F&x+HSjq?^J;wbKܖ:CCCo^ǡVmk矡-As( PNrXO?6 |ى2KelÉ+e 0_exlHC;^u/>BB BpBB-W / MnGM k)P]]ݴ@{}`{ $`l7 ÚԮIizp+ ygaֵީԎ:z:۾Tl\+ گ?[QK.ЖNPhf7mTSgGve);M4ZBl6b,+,f.^R!`.PצǃXhS Pqf;-Q]`qjz06?0`kcQR+}4@/YH+Im6ښJ"-ZT+cAgf@uJxb&,`}NACfO}YՐwyڃ>zK}p5ṶH9emre-y̎TKʰt@|1E9hǫ?UzKHp ,m̛EY˙yyD[LV!9%laRMA9|!(oUv>j޻B滩q.fL͈3Šoam_QjGJcsp8bΆl6߬oLj >*{2 m`Mv8!8l%< 4o8Vf,ٕ QհP?Z+1xԾ]/Lk k8H>#*Ŀy[QeS ؑlӿ ~!52+rZuzk_ZC45o c,_+&.&"2K%oa墫EDS(1_^zc6~?Z69v6V98kNr8)FwvPZ֣exI`bc¶6@ *I2ed|F~S&/*ㄌdM r`?;e9-e\'oGѓPN2*wM?)&2#>Aئ}t c2˸Yƅ2x3M $wd=P}('O:!@JHԾ:|Z&ܒᗖyQ0Ox?%٣+dBdL@ߤ%Q2 ?R]Tc<lLvPfFd0Q(_OIL/(3ᴔA,y _Ui֤^O|PWʶeR%9kdRyeLx9,OʳrRXd̡@d=F!hr Kpyaw;iztfatGgwa2qktI;h{O^KKz(|'ZۡH&BgMXߒE{8C[f[ͪK-ac[aqCVM(1q\DStFcyDrV6[. yq;QՊ\^auB)W;MT&+KZk`2'fMSr^M3|S1/f[5ΠY_ݟ|\2=˽7޻Eb)y+zRi!lDx6݋E mC"^jM!PW1AF60&F*MhCPG 3i958A񠦚` MO<=qR6NG1ܳ1p ,K,O%3yD=U璇-ìPk7IV<Ϭ焇xeV!5]a&@_H ΣCeS:ͩSZƥw靟w~&oMlHYٰ>&E?}zlʱChhLGTMo1ڥs:e"\-bY)-=QzJT*B'Kɖe#Ȳ݆G Đ[ꄀt#HG*4Џh_*doinJfS^잿Y8qL^5n 6?ma`X7{nfz<[j^7@bXv.S=#- "b;/BVZ> @VZmj7m31mFƥ1]BwT(qfsEk1gά6Ng8YIyZF͚0ω\8q.q.\"a׼Kw%]wU""']G?z_H}ѓ~6oEYq`ʱ9Bg8qY<[Y2Faƒ-!ltQhw5[50os*`_*͡cum[^|8{GRRR+wsԇ?̆x8- lqyy-CǔlQOL\#G8bHF 7Fn=fW5;t'ݬ@tkQ[2}.^%3ruya2؝ư!(Boe3uY¹̩"u jSāe;{ iv2.> T=[_o+hk'#iad~ QBCe?z2mFF4z_bke^EjT۽xދI؋'#^ƛ9D6 f#z"jZ-%KotVo?s'`ݷRZ8޵{76muUMGCNlH8t Fó k߀ mFNگYZm}+ kBv7붻IU7>C1f@ܙܢs\[!h,l^xŞ^:L8W = s Z J,)h>z_݊k7uȾ`GNs']xޅ\]`nc:0ÚzEouFځXS>_ZQ@JM88$k:ȡf"o\]]ﶬXlN(达omA`y q-z^)P=WMxAV978q9Y pƼy_{4Uٰ@{zVR\WRWxBWQKXFy^+@,QROHKzpvRn Tn(h-˗M[vn芧h0.j￱cГ$~_,(NW(U!qND Ir$ <uZP6i1N] VP8=L+_"_K}M?p̱Ϧ3`˗6t4ӿ=On|bm.)$q:OyWv xۙC(D^Bo6 äAmoxvn; uØ&mEw999$2J~|Ѿ;UrzYXg8_TɲњPgA F[n?pC   r ͑ A&t"ku8aqm#3^ Ý7~U3pڇfH%fᬏ #e`LqfPSYّ5(9X2*a6Q>{1Q=2 }I"g3Ӱm\71yфMjh\\?>\)ݹSTũt|jOzW&v왎S}-L#ѩ8zfpBLLm\ zx|tFxxČO&"qS1HChݍڎFQpW*[ P'C( :*? VqxQRʍ0h`T( m 4'yhЏCotvNv\ÀWg U?oQ=+@*(7hܟgݷ\*4ʻ(T:!6RuaOvrX址v֞R%t4 &>g%*u;T|B'7&*H3~W9gV.KʘTW}hTyQc}?i?~G7:"DU_-l8'2|)Ό?3FA&:mɧ3x*0yN~T}-a- ‰6_w*p痁zE8{1yGͭ9cE88_5?9?;ayn[GE~ WD-p RY'ȩ.n=Ʌ%񁤷>I$ٺCyY{7YמP`~)'jN}p74oOOi}*4hc0FA{}*s7 endstream endobj 285 0 obj 8226 endobj 286 0 obj <> endobj 287 0 obj <> stream x]n0 > endobj 289 0 obj <> stream xToEfe'nHvkyPJUcBI%H8PZ!e !*!UP4v/=pPe^DY/IT?`~=~5j !GҘ\_bX ?P{a!,=Zg FZ-\j4y#O/^3C^% fiW+n@flȿ=|ϭ`y;3|t yycE@<6xV p sr !נAʠ)NMjlt]gmavFMc)bD` j. ۙΔ[dYe Fp7d۬AUhIP->%Ɍ蚅(BK1CŅBFܷAcXV]T,zbyoq%ކ(b$~Ign<9)s{%&(1|4+e3ccqrx.{cb<;gwaarB_p~)vwgW=k l_>`xo?aPFWڢ rzz/N^LG B:؍E>P_DKFv&% w.ԯ9؍SOn;؃VgFz"t`$DNmdr鄙ZK}a͘\}2t=Rz!+h `q,Ld`] )XCdai3` ƃ CߡX=vSX!}!Ϊ&"!:̇ 5@pE ì@_Sw endstream endobj 290 0 obj 1154 endobj 291 0 obj <> endobj 292 0 obj <> stream x]AO 96&f&=?´؁L)VM<@x7kQ13.qe0H|pPewMJ oKƹ16ү-78=8Y;{@ޯ~Mg j[8=O6=u.;"_mKd USU-4[? }Xd-ISSNc2K2{?'ŴSe}~my endstream endobj 293 0 obj <> endobj 294 0 obj <> stream xռy`Sǵ0>3^IW+[-ے,-YY`;-`X !$R l$-mi$mɂi,]i/K,gd$'sug9s̙3g93bblB #^{,ᘾM֝gA,Bd52=[~_q!MB UC{T4nS"TB>upčbS>׻uA768i[{7 ƶ'!GYg#CއG(G?QTl)2]- q}zMKmD'8AgY"9y^E83?pf;S~D5l^ЙڍUզe%TRUam0`MBT+e[4`cgq)-qiւbF殪Gx`;ec Zlf &OAzAz!LA4 -L^xX)kТ"ƛrhSzyQB`FOh y <0&p I"k( jQ20RzhT թuFx¥| =h0~o`Gĉ섂w[_^yAxR*g YZB@FSb8ӊ\ * p{3,]03JZXj 2M} Z.ЮF[乓m68#0KB 9mDv{ YfJ*y/ډ=m_ڡ42"iӸ i8>{*G=k%*hJbut@@s 9l5daazZm1C",˰%?atjmyFGJx4PL3 `,I~4m#0rʂ尅Jfз ()*FPd]jn ]zXt kMWm̂yu+?qӱ{7fw[j;4JExD(&<[x|۠8g9kD%PaCmtMuml͈a{q<4 %Rk0 'U3kx *XuOVpa%52\gqchjeU VOIGUCR$S7yǏӇhBu<߅m`mfx.BB;p>]hBU3yf) Cٿh~XTaYgg۔8U1 $\H M = $!!0ic^Û`!RMc}0,\Xi&o٬lGs6~)7CgC]+ }Pē45xI->vjk=f|}ɖbё=|pcgx _?%-?,c1Fp>,ự x2n;'PVɒp`ʘy0au8ObLԃűB(}-F\!uqWI܋ո-楷ᥦ}Zv~:jj gIsgH=Vx9xDJĉٺT01d䛑B  :8WuL5SZ25S9%v.^ImZ ^4 $m7^u}M2$5r|g'\`Cs [{RkvQki2l3CKI kK[^qc'Sz[?l: 6eǐDUIx[6:c/Q"X^ #Q0S]FpO]2@)Xsb'bZ=F'?i+-&76Ó.s/V-Q+a9omE|S%zQ'X9^wWs;ܖ,P+}uo޹wzkv9yWoa:*{SHo>r[6^z2b]G]{V0c(sۀ9rVj)k\﹜rHNY[َwΕee@se˘2 g&2pT2`)VFy$;ʶ|,5=x[:CܰAC]%LM-lm® nB)L>*$^gX f[C`uD5qaw h9,!b[+*Ng6KF  v@`L}%2# i6ɻ-C۴@0ctwMq~ My,׻c'SɁ;5Ģ)li+OoM#3bf$VxxȪ05V /o `^yF5C^n\0 d,%|0-eh +؊/켌UnVg( GSj㔼3U&xv%آ}M6w. Gx!DM;"kȊsvw2J+jx^Yl%qBFd[SsJ-lZ Xav7{4]c`ceri3L\>e/<;_'ɧy` i +&ϑaI>{`w#g<]je"'o\;9<#;W:ADDiCJ<9T/j,phJ.KSjjdAL҂dgBz!Tb%i!.Vޭ6Χ2.1RUѩ-z[[O $%u(ĘJAӛUMH8ޜӪQ;#| {K%.6i 9 J5oK4U2LH ykvf5wVosSE ottXy|If[70Q/n<-'KZ[W ̿zEþ+?hlϻtJh;Sg J|K]bna>&c9,rN-c~1ߩUS1  bP+?-ֆJ,aEUۈ jk^v)jYa\j蟫b٫]ɱ Ol"lEMƅ63q\,h1BԊZsڊRWTS:R^,%.3֙-fb[Y_/'"yߨ*i y>b:hÖwOV>WIwfCQmS^Ry2)=~gCo~s`́o lKd8QBɚ{:^|~>GOmSPFAOGxq ͞=8nUh n A6z23cY2C'RQ)bJWDBaF[(>aJd:v=3#8{57`/?"C?x苧G.Wnyv.@3[9'q#68wS.rF4t"$ "tBg{a< 1CMP9鼣[VVc8N0z^^- sGTE#EXTzO!$#*p [`5((rBճԗ@6 >jpo^QG[ufX7Al[N>f[Xd,d[wC 摞<}$OՖ2jgDbQJ0Y:=ʖgs cj $㯈8kYxSk櫿5S>]˚kIIЧO4,|_y4wxy<9}t˵r\t=0}gB?#J3|DT}Fءq#-Jb8EA"Q?BΏ(f ]iJЮ.13X+հ۪kKZZ2Y\< {X/).,僠H^YPp<=11~ȈpH gV\Bp|g"$ɋ%*@!Ҥ$3=<$oX) qx=(@<*~,lO%S؏E& }3mߠNGE"ُEK|H$k#'BUD򪈟}DCFFĩbH2g"gWE'DR#@i"ELD|-"^-b\w3+E)C"WqbHRe{+;"9"b eo-pJ$".`AH~MGDr7I?bHEl9)<蟊i;(8O"A )6zH R<"DqPl>-FD\K[RJ*gO o\l@1%]n*`OYc___1WrkHKv:v:^K;H&ec1ᖙo {Lz j)j7~;s^_pi=N޳I.}L`j!.ȑ t7c1`\w9lۋ7(׃e=$U >ޖ#~T!V7( %JU6.›njx +Bٰrɠe6cknXؽӯ }c+]۳ytLZ*\}_wߡF,X :#Q&D&Nmvel`gﴂaAB_@8Bа򅟱EG8^ɘ&:wuQ6".rvf;v=Toq--9ה&u;:I]S{BEyXgYg/r#'chHFP&%5W \BEE+MxY,Y}/k]_T_($)7R CqX~nd?WƆq.ԩm ñtˁVeasf`eSޚٹ3v=yn2.)Hw`#kݷX߱Cwttt~|utom;kݺl<~%nc_u ywo ).{%=9hK~8voIYI_ewQ>/Ck ?#!??!QP&F(~) PJ?*O2oiPL2KmBِ- _KҺ!Jc2fU͓ ۼ⁑U+yszS>j.[l;{;~oC|nCQREYe}={{w-\^cey;x׌82 T_v,h1Zm[ӇZ}:&j rT]ƒ΍ #&̉KxPu_q[9s_2blxKi^&٫䄞ɮ/*f2}% ңlK˛FO[UU+Y@ee7,ltyۚym &[״FȼzOR>;WZꛙv4UU6vTإ; 3<)APW"Vpqለ t>r]C&F[A)xc.ntL-oC>\j|q$W>zwJjXT8w uE o4,yq߁kbvsHW>o5n^^ɻ>;#<2yemVwz{;Rw5j[:wi}n!{Gi-0ƅx v5\4xM3CO227N_P*HX*h? `_W CR(,H =gL6/s~l>f˷fd-ݱi= ǔ-0߃$U\#:UqmӃa|T.XN}Vab"GH\w,w'/hQv*MNmQ7Աn.ן ~jKPLo^paD8p58#l:,զdSx~M'E5o^v umyw, /uɚw- շmZ{3R^uOӹIJt˪&g-`yƊ漊\d/1K@'Oc6{&VSx_$Z-tS^CٚVNLߛz&\Hũu"IXf挆_ٻ›Wf#/ǡ\r=emL8xyۦfz+IThKIks>84eok|d ZbUqN)0+ڛr?aģ*)a8<s;1ƒ6߇1/%}>|)/|Ljg7NhѹKst3"URVE/?Ri",Rgof)=g.D-"Ũq2jA8^]VH~>}G%#FߵOޟ{o(^&k!7QJTL c _ȩMByIbYhTq5!~w7vb;r1E'2G?_g!On*I▓]zI?M,2% غ.GG菎<6̾Gd?u 1@/t`"2r$Moy/֨L`2`Cgq xt+dzϑ%?~Zxz{"B;eeh xW?ZgNv56R./'xn)?@;$~/ M˷BZ OvCII~WQ2*iq*ZF/5L8PPONxeH[੄G]%i8WC"c6/r~^ %a{9&~%pcܟÊI/K?QiU-!>nSOGDޥ}ZOsawz _C1 6QϙLw~Wws:~2x7ل61jԎGAxᝰݤ. CY"^ze)F:H+m G#iƹ/Pz$Vy&r$B\IH#i ?-t4ڊA2),Ik$Q2 R14@D,d#i1"iJg37 e'"i%G4GQh% F!-U|&0ylh1* [}9}y[qئ<u-4.[{czYohhXP`;<^X?o``̚kRV]ҁqZ*ZOs ưfh|b` yy֦މ kpJի¾^L k7 󮌥&0651iwbb`<0<811Rtp y> lp#CkayַL ?X=qCUk&q C5cH7087hhP9_J#RP4614֠A41xŐjA> 9ZQʃ|״s&-\Q` ݈! P ^e_گ5C? Ր_-Cec+Z߅[*Ì_\kϵzǝs`'.P^x[L%\8ppr@0#1hkx|LO|[a,md#2gJs5gMOWyJ&~@Ø fp.m_.Z^$ y!p3Y-63k}i|✯b |[afd)3>[fւNd-*-=o{[ }!q-*=V|Oꦱ(/[{R2&ٟi<}TmAG1:j=*9:r}GOxV)p˰mIqviWBwwϲқaYyӛouǴsigL{:!V,fx4gZ-M7f5CUYx->RE]u[N0jh2G<#iHvZtU:n霺F]@WwF7SK/6sxjku8- Aeӊ LkRsgP+;WtLa|;AI AwkG'iyCMl4%'"wp8 7R90"OLLpq8r;&6-0$x8"0FDŽOPME:Cr!E#8X X endstream endobj 295 0 obj 14379 endobj 296 0 obj <> endobj 297 0 obj <> stream x]͎@~ 7=c{WBH,,(ll˘oW$rՌ{)hgwsmcs׷S )\>q]3Ǖ}7zLzjdߗgyzOv8OIujqK} U=q7?R#J36MU~NB,Xr:7?iŚ煬-Z=7-9taڿ@8tez+=z7j빥z}~g-rj08k M~Y 6G&i/_Z{ȿ& 6G~og/ߠ#Ւ# tIB&Bw_q/!A/S_Y?j=#?k(jU{WE/3+) 'Zm> endobj 299 0 obj <> stream xԼ{`Tչ7=&3df2dfL L$$ !BBB %*E*آV Jk-ikmZ9jyϱcc}k%o= m||~˚M[֠4V߲r%Buz󳚇%gB!%߻~{Ͻ[! {|횕5sWe#8M_Kܩ mmʃMևWؐ5P?wmk}-޹a-k /DHظyʚFn?i@_Q:4C/W(UZՉzd[m $ӕNIMKx}`n^~AaQqIi\[1&\;nE45/]Ҋ__Gm?ozqȄnEhSvw3Q_gK4:yS>t| g)4zr0:n)WMݎ=Gߣ A뺙ѫ)_*=NKއ( ?p#ڀKv;~:Ї]45Z֠_kt G ]WGGsj<_/c@N5 ~|ͽW{twIU-MK/Zn~mr^\,TZR\TX7'e{3RS.GI/bR*x`@*wus"kKs޽&!kIo.3쒋9o.)ђ=_+)EKJJ,E^g9FyZݕVez|ͥ7ZzrΪ rVMTo];VUI;Qs[3j Ы (gTHeNԪ -U .Wkv"])gyryJIg::<;x^D<1[&JZwT5Ld+'2w|Ogf뮬VSwKSEs/N}ӛSVΤ(Rſ vYMwl[y~zd)Č TF-H>:!vV7M[&pjsJBݮuL?Ft!r5u*z31wU "i],gr6rFfsUrӧYelKvW5>rbd~(D .A,etT} >. ucJ)ʘ(~@;HEn k]5um¾9ILӕ$Br}4?'2l=g+r~pkrWcl~bc#Z eݵ5-=ͽzwb楋7VQqPVv -زe%w.*^=:Y(S-ۆ䵔-yY-a/2`gmvs-ZxL1t4 շjRW,MIq}q3V^=ޮݯŚШ`ro%{ sK?n:i¦̑ tuJ晕6+:nx ]O j(`P~} }vw]5gF9 g;jȰ5-i &"˔ ^ta)rrl ѹz:n$̕[QKKy^<7pd@J(hm*qUj(}N[mK@eRhqTO2xf-akAT\^^|CsATӃIgw$S\_dIe l,8.T^bWGyp)fzAEӟs\*@/ICQhi>d&,Y `1$%$Z%1`Ɠ #1hjՒ5)V{Ëv촃hA{YY"3(S[wi4xD OQxyrgJ2! ^AF2FM8uzA06ˆ"1|NJq'+Kɹx`BÉ-sGzۉ;Czښ ]Ypk.-p,kg9qUͯEhtC벼,i j pDɫbsJ0!L L;]!bh:h %mˡc38iŶgEGrΜ1/h&~ٳgyOW+q9,Kwݰ,#b%Z2OP~=ww{]Lxe[b"V C< ^䝼sJ~$t& ] t0*/0y:+<;/X42 Ѽme6Ǯh?j^TRDG\1r7 ܏G-~[wo#>fN$Hb>#5&#,5} RhUO:`ZPP9 z^+͕益Rsk19+\_b~>=>Go. ͊ dM< .৮\ NN}.<.T]8N`?t}rS.,v \0ŕR&-M蕋r#l ϖP'pk+]M.t\s\ zDžy:b0SfLCwq׸k]\ +F$.O`T?0t ȩr^7] ABx?vN)'znXʯ//H\)0ū-J.,Xx_PY2$Ξ~ǫSE].oɄ[ߘ)Ozb5 +ꖪxx:["^ʃGKZ#~o\%Ϗ񎵔wQzK*{B cLOa;36t #BNl;> x5DY@*OHՏH- 2ŠA6!}@/z^r;O:1%qDɉonrV+ (?ʑ׌̕r:DPOZ(!+$3]pݔ7ͨ@3+`HHomڶ Ro4n[kw=bޝSO厩fWE(F)0q_A ]&Iaᱎw 4g I"E6&:cA6]fJCP?vo.3*1glުܫkʠ9fM n+/i$4d@m)V^;'@, ֌(5%yFgY#7k8kk&jj`H5W2uQ7l9㲬3& ύ}zM`!E7bA틨)Af RePoR|`S:{CiT<Yyl'|?Ŕs{Vu8U9ei5Jmu uۖ>YW{;/޻o ??W zrbU(Ce۟(-/ ]&cDt q t #np˺1._=id%+ڐUcFz^gI[.B90eR=堗A BIMek,@hzk3ΞU0'p)?~jm״nNt<'3g/ %)=WW1rҫLTjшvWX4$hL D}IʣQ4rDa\QI%3HIE%3'[#X}X\TJR D'h$zA*ff z;-dm *zAE};@yt0 Bw7B0Օ&2W[]_ZMmgAbr-=ZN7PEhPBtZ 4˘*4n!7iJNJ&yIUIxO0ܜֆGmj˳Uٶ8 M&AH㩐ZJ8&G+̰UYmT0qЦD#ٹm!:$Q:fg|HJhOnͽ+\R \߹1 Z. Yvv (@odzU'"YʓY2C&%Lg E,풟u6EQK⹿V$e2^-^}_O==E*ꌆ7¸-^jO|=swm]=Gn &mnjiaE7><+q{+X.m7t4i9*)) ү{VV^#HiilVV5 ?~vPP+ad Cp>YJzi 1QW#&`BfE"OA H,'_Xk ebD/DSPJ7,s X,I NѸU k:C/+g--7y[ӥ7\"ToGcCLWp{8nbtyW٘ձ?<>m<88&>%b5,BsLj HV&e Q):&iӴLoMDi}dR;40Y5ʞy_߾21jB4Y~n{dpo+ۇp[8*=s;]_*2J:h.@5Kd:a$g5zR H+jK+Z^*di&n7y'Eq2F:.5WٔY?7!ɒy%-*1ٽGetwpŲ"_J!#(9,q% GO=%i0qg$~g?YW曲Fgahwq ;1a(/]J䟓y,m8^3RsYT>q]&x>x:tSG nD:|Wߊy4?zrsyIv89ȎȰ혍egDŪOL R܈/122d0JcfZ`L ۍ;7x>ks2vs4 1Vx,N݃ks֋~M-QCP3ֆ;{–omڎ]֗o;?ZzpzmUN<E Ucn;ȩӋzJ|;jvEi#wyĥ^-ik qg7giUjPì)GSR0t9n 3'x fH#u԰cmS\ qfn Հڒf !7dds=3'99,sFKn!^2w]fbD.G7͋=ɨZZ4^07/nO\S*k;swT3Jܞ޲+&G#sS-߉99tpTGo9Xba]N=&jlS80 Kt`p=UtlVY,)ACTv18G@{Sk^cdVE& 呟@Ar{ȭ=%5fS-thFG(A*}z<ϖ=xKpOoGc]Nm@aoSP^isi[ӭjsÜ9(~ #p.4YC6xw,O[v[Qp{W)nޥ%՚b $h$/Ʉr]{XpP0S?wcThR0V}[N} Uv;j9 Q(TjPr r[ /A1SSD{|BC^$ӐQ (4ijMfBK* ];LXK@EY#)4R-Tj!_ )ZhG/--P FZP je-)-(ڥ7>}E#p^`-{F/>?e hj m,MŴK|L{f>bVi[Knn$lm< hcQվw.ʽYl4ZGK*EZHւ ol.RCjaD;=%CZB$-jI!8lfZVZTsV)tGA"=W0צΨ.o&y:ώ LHv眠 &/[`ȟW "b!Ƚ~^iG>z+WR3x`K!]`vM `N8Ajt&0e83G2qRi5vAvکܝqw= 񱂻ɂgly6rg"{e?8gl sw4{~Msd }QO@!UȔ8*-m\.bC|A4'4IR>K(EL \IT)(+x:flZfP;,Fs 6<3q#gM&cp>7C?mpS n_e.E>4@A؜&`9HvL 8ҢdqX-eC ؐ7q(@17y0yl@JDQӔf.y}-~y!G>b>Ƚq032<㍟=çr0<1!x˺jnMKKr< LV=,1=\ԩ< z۶*hƖpSySʚJv24H.FH~CտO~x#?[SJfGJU^ 8D^ A_h{6PIOB^^ K -* !'B/?t4BO^/muut{huкǺ$O.0)[Y34|i̱.$)rQ۵BX[B;u!(g͂.hЁSCF~Cl0DOkl:̦ȆJ>g "Һʕt!(z&~"'C0ĪDFݱh)V%8xdh2!I3?j1QIy-:9kߌySMZըet&%Db :D9DA箳ºD_Z-5޺ R̈juSj%Sw=f̧J@H6yjNf۬_D"T;~;i?d?aWgveI'h)ipVن]6yj-y~5ub?-+w9vd>E>I 4D8:I2"#8Ь,ɖ߿!~Dz%MRB'ixDb*dTd25VV;0:%JẫHv`^!shƠ)1(s+.]wOmwM=@@#]tn1h FV?("aČ`)>f"ǜ1,+6-3| ԇtڲ3 .^8煣^!HL/VxW_缬!oz1z{{J@|wg[ oB7+ J/N-{ /c^V6n/`EMb W@r\ǻՋgg$ffVʅxIɋg N yGYv5IaE,^9G^|{ʋ T|/6h xG&T]]*ZKXL|1}9YԎ"mku6lUYUdA)k8?:T"{=Ԇpq~+}8?:kݸ(6 XkB5X3dmdD~b-gcw҂W+qbgU8ס q ,PT,Xty~4k挢\dgՃ;K#urEN2P1Qݙ6^ǥ9Aqr(>!LSj]m+ $s4]&mO#!=mzxY6s&51̠z>1tߚE,9oBy4oMbQGV:V~zR:pzz IE+). ,BmY8A֬l4-n `>Jy݄cVJ0/c٬KVaNfO^t3ӱ4{`G$3bvR(Y U/Y`~^55w&jSisme9Ly>Q+wFZt-BʾK w b x*x!*DQ1Bόm:x9i%2Ξd5j;[<+Yy- D9p ):ɴl~xS0,I1)'úQAr\9p_COe&XFv~cӣg2X&:( CЈd3q0kf1<))'gSIӟRre;z77Ǔqlh61c15/Pښ0=ŒB;q#~bn?. L8}y%y[gQI54Xkۣ?|tw{ϬDQ'͑2cO3g@;_vծ2m;sH;n|G랍|qB/m.u #'#4ҋ)A> H;czEG~,GjXZSY¶BR_^]%Hj&*$tqރ9H5*ШTXβg夾bntV%ܞ{w.bfɲħfH CX=>:^݈ޒ:l91 Fg#i׽k\=΢ Hvb mEߪw"`ǬHk?z"Y;ߑC ?.#?٠'_lI,Ikb(Q.MU( Tnѕs,U[jnoȨ}aSiWmA~|h𤕭[?,};6oA]Ǒ^+oraw[ ޹,suնjgRZ){ɶ?ѓq2h6'kgr`׿g4S]@Q@Ryk!~wvz/#=TjmzFkR&DaQV0Ipց,qS㝍v.EPiyH~`of}$^_sjM&jlYPR!͚e%̴*.6U[=8/48R쭏ⅸb8hup: 1pv1Ո{!T󫪫0\M3T DL]by"NlnPYf~J CJd [ 0ZDy c"̯-T\]G9FAi&05 Dyk8iA-Җ63-1{:jr*/)9`׽:ĖX9NM;4g~멊awZʂ-Wwh]}K\ -rWln۲εՕm9^pFmO-*]|ᾏvtdfc bWy0p@hǰseT-3ad9]ÐH?}8hMdƤ$xg\A {)9*;!5o> N||.eLS>&Hr9ªGNb}>\bEq`ծuHh7^q],ɇ+}䋶0c~SVqҒɱVx:IVVױPs|)gᤄ(QJD9zL@l'u))$ D>8s7|9>.gZzso.=F nɟ~_D8R1iὑC Nԋ'[&lR_~o0L*I]F?.ߛ~uo*(Ҋ2s~m (wP 尘 ; R' HYoy.3 ~_]/b1ߑכn34ka@[:ezmƃFb3--^loǪ|04`eh%]V ؙGNpN'[N=A!Üh$XqꘕEa4n޷*9KGVV'<ى-(Aαe??^=7}[Q>zTٿƏ<\u|ZX30[<'X%fgq8p$FG@MR!~Ppp& aq!,ĺB!Xx]ʒ5 ўs'_뇡op0P>ˆ(d 2M1|m5_Oy !|UOl+o1n]Eժ=!YM`6HWtU>q9>2k>EI-€D0/i-LA#ZB ԂҤ՞~9m[{Xsk^mvX}-@-&ZR`Qa8meZU<</o]wg<-4wb$FZm QQ!W+*{$E6ae"&EŇ R$(v j MayH˻Ó88 iKM4tkF5\Yvj$?h) iRbreaTqj5N)'kESXA9(Y8@4#Gz'{< E k?V.IT?~q?I;\@H[&n= ӥõbFcpu HKµII}Idc89zlh^=Mv-YeG؍` JԄGp0vB]l{X椊 bbc ~I96U%XŖTD$8K<Q8#HRzdp: YF-آLOg0[vVvq6!lf)EW}p|0샍>hb NO&| x EWwEDTB6>݃:ENiaݭ P]:4@@A7pk{WTiP_ p}Zʊ<e XZk5 @|W~E2rVZ&kk<x29m;E Q/G_|`:@[d }^4R vo ,@]J @b4Ogȶnṳo0H: q!>B2@$  WDA%#OSo]%(D=ѕLޭtݳfNu߮uOWu[~|נTdiy@9g4@G5اA+FW 5AV % >/hpD4@w  |/HO !~& xTkk'sZf"X|PF kJjꝩcق`}`8|\E)Ώu~k~/i[x~?v ~K~̰TWrpT"UUƟs OFMo$L|\&~KH&Ļ⿽+;p[U٦'.Tf`weߟVgM͝>U{e [ʞ~ü93gLuJ9ƙs7 5sycrn{FӦQ׭@mmM*nnJMh\ ]c&IoE'[p;142{kJG$qq)KXQ5M~5Zn2i5 lɾyܘQ:n梂3\p:l:؝We͵EsfLdꂼo=‡gMjao+`|􅰑~okzzT>GO%S)@UUBɥ'b20TH^ɐ>H[}!UWU;T&j3l#Hlmu۾6(sÞ R8-K'x~gsS/VpK{jjzU?LlfťqQ/L wľI>U2#u4oQ#3EB" ag񎠝#YARAuM5"{Q?b%z}UIlAWN:C򍾺VO: `enG+o̴ Bב;DZA`)k-P Tzs 4jC,PŤ2W2ؿ;Hb |Na=qSCMŽ;O?{ ʖޙ޽W>$,aK͐`+A :a"cYlKTK",&(KT@/R 5QGY;{IX80Ǿg3ㇱG~ ) & s&3x_g3zAleeXUz3F|9Fw1k2Vkl`1[PɌ F2sZFQѹ <\2ȽU(kc1Kx*ۡgBws1T9sN@̻<fʻ/T㲨,Q"(-Y-"8PWCf*kZ- sܷ}EtXHq/~`o' Jet>>.:isÃ7~~7< #-P q>bݟv42^+!vS2_kBI%Lҥ/^z12b x~͒'oBuRuVu{_qMZH}ĺcIL.]xw<ċ˅qIy.p RxU—{.,(08P!0-eI\Ğ/' sjŹhiljYHE@\)-jnű"DAIb"k'J~GbjP{L|+9N<Ϥ @#UΓ~dwךgCx~4R %R14<'+݄)FDҰS￷xN1s`JcON:asJvd$%'$` dKq$<ܝ49l Ve DMwvGbJ0a+)ϑVա$;]RdcB\pq짝9 |_wZ_\o*t x0"'R"c-[{@⊺nyERS6VͿZUZڶmkmkU<SI6ITSzE,=)A/Yd0ϒ^Q*m0^RTkx& o%co*S'-2򻭺δ+N6lpFU@+MQ$m`rå% ܉cD g)?-37m-H[7h6+? n2 !Dz }?Gb˶"[_|ݷTqOX"WAjDb>"2*o̥ؿ#d/ $dLH."!;RNCx6tcvbx_cF C j~4K0ې Sc°HTprI'de4LO N|}ʎqpm H&yH#'qk, !E} Y 0 ,A񳔁^29p;;9 26=nҲls<ߝIXcM^om[&ԋBVˎD[b4)'K/SS;F^vu;]L^A2nq׺<5bH:28~F>1ύK7mNx•;>iפ73'fnFjwhhf/L̹۷wcI'},&.t_cdK:5`q2`}l¹݀d39a Gl0πQ%_<̈́[I3Ӵ/M˨g d$0%6iK)ˀe)7`-l"ңl&H 8ad|ɀOӆyN~ScMUuѴš O,:3<3##P$Ը!Tuyg_䩉x<ƲupoYj,քY5 C7@0.L*SjSUH˜r<o(|RF42's<_-]%DmF.B%@5VOpG fkrj.b=7 *DEkFukKA\(⣢jqUOԒE6&\Mܠ)Q/1$Z q4c*}}x]m\)μ#"G%)m5X!Qbؠqj3L<7o6mR> endobj 302 0 obj <> stream x]͎@~ 7Bba8Ga`,c}\]DTQ϶ݡkٷVӘۮꔟҥ2'y֣=}l61]Zeӻ8>Wn̋lΛt|/54L: x)}vDoMUlU|߯5[,r:?a uShQHS/Dձ.U?W=^2f y~;kwF=+x&9& fGMG~u5}eMGu0#?~3i!A1Kx"? 8s++Q5~IR)2Ɠ'=x<5sx/v-Ojoӓ_/>x?~ C0~3K[ ķƯ}E[` x{|@?fmtԨQ? fvxGƿeb[k{Ϻ0LJ(lKg둥<8 endstream endobj 303 0 obj <> endobj 304 0 obj <> endobj 305 0 obj <> /ProcSet[/PDF/Text/ImageC/ImageI/ImageB] >> endobj 1 0 obj <>/Contents 2 0 R>> endobj 10 0 obj <>/Contents 11 0 R>> endobj 13 0 obj <>/Contents 14 0 R>> endobj 16 0 obj <>/Contents 17 0 R>> endobj 19 0 obj <>/Contents 20 0 R>> endobj 22 0 obj <>/Contents 23 0 R>> endobj 25 0 obj <>/Contents 26 0 R>> endobj 28 0 obj <>/Contents 29 0 R>> endobj 35 0 obj <>/Contents 36 0 R>> endobj 38 0 obj <>/Contents 39 0 R>> endobj 44 0 obj <>/Contents 45 0 R>> endobj 47 0 obj <>/Contents 48 0 R>> endobj 58 0 obj <>/Contents 59 0 R>> endobj 73 0 obj <>/Contents 74 0 R>> endobj 79 0 obj <>/Contents 80 0 R>> endobj 85 0 obj <>/Contents 86 0 R>> endobj 91 0 obj <>/Contents 92 0 R>> endobj 99 0 obj <>/Contents 100 0 R>> endobj 102 0 obj <>/Contents 103 0 R>> endobj 105 0 obj <>/Contents 106 0 R>> endobj 108 0 obj <>/Contents 109 0 R>> endobj 111 0 obj <>/Contents 112 0 R>> endobj 114 0 obj <>/Contents 115 0 R>> endobj 117 0 obj <>/Contents 118 0 R>> endobj 120 0 obj <>/Contents 121 0 R>> endobj 123 0 obj <>/Contents 124 0 R>> endobj 126 0 obj <>/Contents 127 0 R>> endobj 129 0 obj <>/Contents 130 0 R>> endobj 132 0 obj <>/Contents 133 0 R>> endobj 135 0 obj <>/Contents 136 0 R>> endobj 138 0 obj <>/Contents 139 0 R>> endobj 141 0 obj <>/Contents 142 0 R>> endobj 144 0 obj <>/Contents 145 0 R>> endobj 147 0 obj <>/Contents 148 0 R>> endobj 150 0 obj <>/Contents 151 0 R>> endobj 153 0 obj <>/Contents 154 0 R>> endobj 156 0 obj <>/Contents 157 0 R>> endobj 159 0 obj <>/Contents 160 0 R>> endobj 162 0 obj <>/Contents 163 0 R>> endobj 165 0 obj <>/Contents 166 0 R>> endobj 168 0 obj <>/Contents 169 0 R>> endobj 171 0 obj <>/Contents 172 0 R>> endobj 174 0 obj <>/Contents 175 0 R>> endobj 177 0 obj <>/Contents 178 0 R>> endobj 180 0 obj <>/Contents 181 0 R>> endobj 183 0 obj <>/Contents 184 0 R>> endobj 186 0 obj <>/Contents 187 0 R>> endobj 306 0 obj <> endobj 307 0 obj < /Dest[19 0 R/XYZ 79 704.6 0]/Parent 306 0 R/Next 310 0 R>> endobj 308 0 obj < /Dest[22 0 R/XYZ 91.7 720.7 0]/Parent 307 0 R/Next 309 0 R>> endobj 309 0 obj < /Dest[22 0 R/XYZ 91.7 598 0]/Parent 307 0 R/Prev 308 0 R>> endobj 310 0 obj < /Dest[25 0 R/XYZ 79 716.6 0]/Parent 306 0 R/Prev 307 0 R/Next 324 0 R>> endobj 311 0 obj < /Dest[25 0 R/XYZ 91.7 655.6 0]/Parent 310 0 R/Next 315 0 R>> endobj 312 0 obj < /Dest[25 0 R/XYZ 101.2 619.9 0]/Parent 311 0 R/Next 313 0 R>> endobj 313 0 obj < /Dest[25 0 R/XYZ 101.2 512.5 0]/Parent 311 0 R/Prev 312 0 R/Next 314 0 R>> endobj 314 0 obj < /Dest[25 0 R/XYZ 101.2 413.8 0]/Parent 311 0 R/Prev 313 0 R>> endobj 315 0 obj < /Dest[25 0 R/XYZ 91.7 315.1 0]/Parent 310 0 R/Prev 311 0 R/Next 316 0 R>> endobj 316 0 obj < /Dest[35 0 R/XYZ 91.7 704.6 0]/Parent 310 0 R/Prev 315 0 R/Next 322 0 R>> endobj 317 0 obj < /Dest[38 0 R/XYZ 101.2 271.5 0]/Parent 316 0 R/Next 318 0 R>> endobj 318 0 obj < /Dest[44 0 R/XYZ 101.2 716.6 0]/Parent 316 0 R/Prev 317 0 R/Next 319 0 R>> endobj 319 0 obj < /Dest[44 0 R/XYZ 101.2 530.1 0]/Parent 316 0 R/Prev 318 0 R/Next 320 0 R>> endobj 320 0 obj < /Dest[44 0 R/XYZ 101.2 357.4 0]/Parent 316 0 R/Prev 319 0 R/Next 321 0 R>> endobj 321 0 obj < /Dest[73 0 R/XYZ 101.2 708.7 0]/Parent 316 0 R/Prev 320 0 R>> endobj 322 0 obj < /Dest[79 0 R/XYZ 91.7 704.6 0]/Parent 310 0 R/Prev 316 0 R/Next 323 0 R>> endobj 323 0 obj < /Dest[85 0 R/XYZ 91.7 708.7 0]/Parent 310 0 R/Prev 322 0 R>> endobj 324 0 obj < /Dest[91 0 R/XYZ 79 704.6 0]/Parent 306 0 R/Prev 310 0 R/Next 334 0 R>> endobj 325 0 obj < /Dest[99 0 R/XYZ 91.7 695.8 0]/Parent 324 0 R/Next 328 0 R>> endobj 326 0 obj < /Dest[99 0 R/XYZ 101.2 632.7 0]/Parent 325 0 R/Next 327 0 R>> endobj 327 0 obj < /Dest[99 0 R/XYZ 101.2 330.1 0]/Parent 325 0 R/Prev 326 0 R>> endobj 328 0 obj < /Dest[99 0 R/XYZ 91.7 213.5 0]/Parent 324 0 R/Prev 325 0 R>> endobj 329 0 obj < /Dest[102 0 R/XYZ 101.2 704.6 0]/Parent 328 0 R/Next 330 0 R>> endobj 330 0 obj < /Dest[105 0 R/XYZ 101.2 708.7 0]/Parent 328 0 R/Prev 329 0 R/Next 331 0 R>> endobj 331 0 obj < /Dest[105 0 R/XYZ 101.2 468.4 0]/Parent 328 0 R/Prev 330 0 R/Next 332 0 R>> endobj 332 0 obj < /Dest[108 0 R/XYZ 101.2 300.4 0]/Parent 328 0 R/Prev 331 0 R/Next 333 0 R>> endobj 333 0 obj < /Dest[111 0 R/XYZ 101.2 528.7 0]/Parent 328 0 R/Prev 332 0 R>> endobj 334 0 obj < /Dest[117 0 R/XYZ 79 708.7 0]/Parent 306 0 R/Prev 324 0 R/Next 338 0 R>> endobj 335 0 obj < /Dest[117 0 R/XYZ 91.7 666.1 0]/Parent 334 0 R/Next 336 0 R>> endobj 336 0 obj < /Dest[117 0 R/XYZ 91.7 492.8 0]/Parent 334 0 R/Prev 335 0 R/Next 337 0 R>> endobj 337 0 obj < /Dest[117 0 R/XYZ 91.7 299.1 0]/Parent 334 0 R/Prev 336 0 R>> endobj 338 0 obj < /Dest[120 0 R/XYZ 79 704.6 0]/Parent 306 0 R/Prev 334 0 R/Next 354 0 R>> endobj 339 0 obj < /Dest[120 0 R/XYZ 91.7 666.6 0]/Parent 338 0 R/Next 346 0 R>> endobj 340 0 obj < /Dest[120 0 R/XYZ 101.2 550.8 0]/Parent 339 0 R/Next 341 0 R>> endobj 341 0 obj < /Dest[123 0 R/XYZ 101.2 708.7 0]/Parent 339 0 R/Prev 340 0 R/Next 342 0 R>> endobj 342 0 obj < /Dest[126 0 R/XYZ 101.2 704.6 0]/Parent 339 0 R/Prev 341 0 R/Next 343 0 R>> endobj 343 0 obj < /Dest[129 0 R/XYZ 101.2 720.7 0]/Parent 339 0 R/Prev 342 0 R/Next 344 0 R>> endobj 344 0 obj < /Dest[132 0 R/XYZ 101.2 704.6 0]/Parent 339 0 R/Prev 343 0 R/Next 345 0 R>> endobj 345 0 obj < /Dest[135 0 R/XYZ 101.2 720.7 0]/Parent 339 0 R/Prev 344 0 R>> endobj 346 0 obj < /Dest[147 0 R/XYZ 91.7 708.7 0]/Parent 338 0 R/Prev 339 0 R/Next 353 0 R>> endobj 347 0 obj < /Dest[147 0 R/XYZ 101.2 544.6 0]/Parent 346 0 R/Next 348 0 R>> endobj 348 0 obj < /Dest[150 0 R/XYZ 101.2 684.8 0]/Parent 346 0 R/Prev 347 0 R/Next 349 0 R>> endobj 349 0 obj < /Dest[153 0 R/XYZ 101.2 708.7 0]/Parent 346 0 R/Prev 348 0 R/Next 350 0 R>> endobj 350 0 obj < /Dest[156 0 R/XYZ 101.2 704.6 0]/Parent 346 0 R/Prev 349 0 R/Next 351 0 R>> endobj 351 0 obj < /Dest[159 0 R/XYZ 101.2 708.7 0]/Parent 346 0 R/Prev 350 0 R/Next 352 0 R>> endobj 352 0 obj < /Dest[162 0 R/XYZ 101.2 704.6 0]/Parent 346 0 R/Prev 351 0 R>> endobj 353 0 obj < /Dest[174 0 R/XYZ 91.7 704.6 0]/Parent 338 0 R/Prev 346 0 R>> endobj 354 0 obj < /Dest[186 0 R/XYZ 79 704.6 0]/Parent 306 0 R/Prev 338 0 R>> endobj 355 0 obj < /Dest[186 0 R/XYZ 185.6 476.8 0]/Parent 354 0 R>> endobj 253 0 obj <> endobj 189 0 obj <> >> endobj 190 0 obj <> endobj 191 0 obj <> endobj 192 0 obj <> endobj 193 0 obj <> endobj 194 0 obj <> endobj 195 0 obj <> endobj 196 0 obj <> endobj 197 0 obj <> endobj 198 0 obj <> endobj 199 0 obj <> endobj 200 0 obj <> endobj 201 0 obj <> endobj 202 0 obj <> endobj 203 0 obj <> endobj 204 0 obj <> endobj 205 0 obj <> endobj 206 0 obj <> endobj 207 0 obj <> endobj 208 0 obj <> endobj 209 0 obj <> endobj 210 0 obj <> endobj 211 0 obj <> endobj 212 0 obj <> endobj 213 0 obj <> endobj 214 0 obj <> endobj 215 0 obj <> endobj 216 0 obj <> endobj 217 0 obj <> endobj 218 0 obj <> endobj 219 0 obj <> endobj 220 0 obj <> endobj 221 0 obj <> endobj 222 0 obj <> endobj 223 0 obj <> endobj 224 0 obj <> endobj 225 0 obj <> endobj 226 0 obj <> endobj 227 0 obj <> endobj 228 0 obj <> endobj 229 0 obj <> endobj 230 0 obj <> endobj 231 0 obj <> endobj 232 0 obj <> endobj 233 0 obj <> endobj 234 0 obj <> endobj 235 0 obj <> endobj 236 0 obj <> endobj 237 0 obj <> endobj 238 0 obj <> endobj 239 0 obj <> >> endobj 240 0 obj <> >> endobj 241 0 obj <> >> endobj 242 0 obj <> >> endobj 243 0 obj <> >> endobj 244 0 obj <> >> endobj 245 0 obj <> endobj 246 0 obj <> endobj 247 0 obj <> endobj 248 0 obj <> endobj 249 0 obj <> endobj 250 0 obj <> endobj 251 0 obj <> endobj 252 0 obj <> endobj 356 0 obj <> endobj 357 0 obj < /Creator /Producer /CreationDate(D:20110428142522-04'00')>> endobj xref 0 358 0000000000 65535 f 0000948892 00000 n 0000000019 00000 n 0000001131 00000 n 0000005210 00000 n 0000001152 00000 n 0000004981 00000 n 0000005191 00000 n 0000033217 00000 n 0000033513 00000 n 0000949038 00000 n 0000033533 00000 n 0000039133 00000 n 0000949213 00000 n 0000039155 00000 n 0000048242 00000 n 0000949676 00000 n 0000048264 00000 n 0000053738 00000 n 0000949923 00000 n 0000053760 00000 n 0000060896 00000 n 0000950090 00000 n 0000060918 00000 n 0000067653 00000 n 0000950257 00000 n 0000067675 00000 n 0000074739 00000 n 0000950448 00000 n 0000074761 00000 n 0000080026 00000 n 0000080048 00000 n 0000099567 00000 n 0000099590 00000 n 0000102342 00000 n 0000950615 00000 n 0000102364 00000 n 0000108179 00000 n 0000950782 00000 n 0000108201 00000 n 0000113908 00000 n 0000113930 00000 n 0000150836 00000 n 0000185409 00000 n 0000950930 00000 n 0000185432 00000 n 0000192273 00000 n 0000951097 00000 n 0000192295 00000 n 0000196855 00000 n 0000210688 00000 n 0000196877 00000 n 0000208337 00000 n 0000208360 00000 n 0000210666 00000 n 0000224825 00000 n 0000224848 00000 n 0000227506 00000 n 0000951264 00000 n 0000227528 00000 n 0000232914 00000 n 0000346090 00000 n 0000319385 00000 n 0000276643 00000 n 0000232936 00000 n 0000272990 00000 n 0000276621 00000 n 0000315650 00000 n 0000319363 00000 n 0000342581 00000 n 0000346068 00000 n 0000372758 00000 n 0000376781 00000 n 0000951431 00000 n 0000376803 00000 n 0000382355 00000 n 0000382377 00000 n 0000412800 00000 n 0000430368 00000 n 0000951579 00000 n 0000430391 00000 n 0000435179 00000 n 0000435201 00000 n 0000492248 00000 n 0000493534 00000 n 0000951727 00000 n 0000493556 00000 n 0000498350 00000 n 0000498372 00000 n 0000553790 00000 n 0000556378 00000 n 0000951875 00000 n 0000556400 00000 n 0000561336 00000 n 0000561358 00000 n 0000593055 00000 n 0000593032 00000 n 0000622532 00000 n 0000636802 00000 n 0000952023 00000 n 0000636825 00000 n 0000643154 00000 n 0000952172 00000 n 0000643177 00000 n 0000648067 00000 n 0000952322 00000 n 0000648090 00000 n 0000654190 00000 n 0000952472 00000 n 0000654213 00000 n 0000659888 00000 n 0000952622 00000 n 0000659911 00000 n 0000666093 00000 n 0000952772 00000 n 0000666116 00000 n 0000672721 00000 n 0000952949 00000 n 0000672744 00000 n 0000679020 00000 n 0000953099 00000 n 0000679043 00000 n 0000689457 00000 n 0000953249 00000 n 0000689481 00000 n 0000699760 00000 n 0000953399 00000 n 0000699784 00000 n 0000709743 00000 n 0000953549 00000 n 0000709766 00000 n 0000720117 00000 n 0000953699 00000 n 0000720141 00000 n 0000730314 00000 n 0000953849 00000 n 0000730338 00000 n 0000735753 00000 n 0000953999 00000 n 0000735776 00000 n 0000740697 00000 n 0000954149 00000 n 0000740720 00000 n 0000745680 00000 n 0000954299 00000 n 0000745703 00000 n 0000750479 00000 n 0000954449 00000 n 0000750502 00000 n 0000757490 00000 n 0000954599 00000 n 0000757513 00000 n 0000763756 00000 n 0000954749 00000 n 0000763779 00000 n 0000770039 00000 n 0000954899 00000 n 0000770062 00000 n 0000776319 00000 n 0000955049 00000 n 0000776342 00000 n 0000782642 00000 n 0000955199 00000 n 0000782665 00000 n 0000788048 00000 n 0000955349 00000 n 0000788071 00000 n 0000793178 00000 n 0000955499 00000 n 0000793201 00000 n 0000798299 00000 n 0000955649 00000 n 0000798322 00000 n 0000803514 00000 n 0000955799 00000 n 0000803537 00000 n 0000809172 00000 n 0000955949 00000 n 0000809195 00000 n 0000814600 00000 n 0000956099 00000 n 0000814623 00000 n 0000819784 00000 n 0000956249 00000 n 0000819807 00000 n 0000824958 00000 n 0000956399 00000 n 0000824981 00000 n 0000830628 00000 n 0000967671 00000 n 0000967823 00000 n 0000967943 00000 n 0000968060 00000 n 0000968179 00000 n 0000968299 00000 n 0000968419 00000 n 0000968539 00000 n 0000968659 00000 n 0000968779 00000 n 0000968899 00000 n 0000969018 00000 n 0000969138 00000 n 0000969256 00000 n 0000969374 00000 n 0000969493 00000 n 0000969613 00000 n 0000969733 00000 n 0000969852 00000 n 0000969969 00000 n 0000970086 00000 n 0000970203 00000 n 0000970322 00000 n 0000970437 00000 n 0000970557 00000 n 0000970677 00000 n 0000970797 00000 n 0000970917 00000 n 0000971037 00000 n 0000971155 00000 n 0000971274 00000 n 0000971393 00000 n 0000971511 00000 n 0000971627 00000 n 0000971743 00000 n 0000971859 00000 n 0000971978 00000 n 0000972097 00000 n 0000972216 00000 n 0000972333 00000 n 0000972450 00000 n 0000972568 00000 n 0000972686 00000 n 0000972805 00000 n 0000972922 00000 n 0000973039 00000 n 0000973157 00000 n 0000973271 00000 n 0000973387 00000 n 0000973505 00000 n 0000973621 00000 n 0000973768 00000 n 0000973919 00000 n 0000974121 00000 n 0000974258 00000 n 0000974441 00000 n 0000974589 00000 n 0000974709 00000 n 0000974832 00000 n 0000974953 00000 n 0000975075 00000 n 0000975192 00000 n 0000975314 00000 n 0000975432 00000 n 0000967217 00000 n 0000830651 00000 n 0000845638 00000 n 0000845662 00000 n 0000845876 00000 n 0000846413 00000 n 0000846809 00000 n 0000854132 00000 n 0000854155 00000 n 0000854359 00000 n 0000854735 00000 n 0000854977 00000 n 0000863850 00000 n 0000863873 00000 n 0000864069 00000 n 0000864497 00000 n 0000864786 00000 n 0000876064 00000 n 0000876088 00000 n 0000876287 00000 n 0000876793 00000 n 0000877150 00000 n 0000889835 00000 n 0000889859 00000 n 0000890069 00000 n 0000890535 00000 n 0000890863 00000 n 0000896779 00000 n 0000896802 00000 n 0000896999 00000 n 0000897291 00000 n 0000897455 00000 n 0000905770 00000 n 0000905793 00000 n 0000905992 00000 n 0000906387 00000 n 0000906641 00000 n 0000907883 00000 n 0000907906 00000 n 0000908100 00000 n 0000908392 00000 n 0000908556 00000 n 0000923024 00000 n 0000923048 00000 n 0000923253 00000 n 0000923830 00000 n 0000924260 00000 n 0000947069 00000 n 0000947093 00000 n 0000947291 00000 n 0000947966 00000 n 0000948488 00000 n 0000948624 00000 n 0000956549 00000 n 0000956609 00000 n 0000956853 00000 n 0000956999 00000 n 0000957191 00000 n 0000957553 00000 n 0000957815 00000 n 0000958086 00000 n 0000958282 00000 n 0000958549 00000 n 0000958796 00000 n 0000959131 00000 n 0000959318 00000 n 0000959498 00000 n 0000959670 00000 n 0000959854 00000 n 0000960021 00000 n 0000960256 00000 n 0000960450 00000 n 0000960731 00000 n 0000960945 00000 n 0000961164 00000 n 0000961407 00000 n 0000961669 00000 n 0000961841 00000 n 0000962014 00000 n 0000962191 00000 n 0000962388 00000 n 0000962584 00000 n 0000962846 00000 n 0000963005 00000 n 0000963173 00000 n 0000963336 00000 n 0000963571 00000 n 0000963754 00000 n 0000963914 00000 n 0000964091 00000 n 0000964404 00000 n 0000964777 00000 n 0000965162 00000 n 0000965342 00000 n 0000965550 00000 n 0000965710 00000 n 0000965887 00000 n 0000966056 00000 n 0000966257 00000 n 0000966434 00000 n 0000966614 00000 n 0000966797 00000 n 0000966986 00000 n 0000975552 00000 n 0000975670 00000 n trailer < ] /DocChecksum /07716234C7B5E8FEAAEFAF45E3CB4EBC >> startxref 975928 %%EOF